ID: 913445628

View in Genome Browser
Species Human (GRCh38)
Location 1:118947710-118947732
Sequence CTGCAAGTATGGATTAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913445628_913445634 22 Left 913445628 1:118947710-118947732 CCATGCTTAATCCATACTTGCAG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 913445634 1:118947755-118947777 TGAGACTCGGTGAAGCAAAGTGG 0: 1
1: 0
2: 1
3: 14
4: 186
913445628_913445633 9 Left 913445628 1:118947710-118947732 CCATGCTTAATCCATACTTGCAG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 913445633 1:118947742-118947764 GAGATGAGGAAACTGAGACTCGG 0: 1
1: 31
2: 266
3: 1071
4: 2645
913445628_913445630 -5 Left 913445628 1:118947710-118947732 CCATGCTTAATCCATACTTGCAG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 913445630 1:118947728-118947750 TGCAGTGCCCATTAGAGATGAGG 0: 1
1: 0
2: 0
3: 5
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913445628 Original CRISPR CTGCAAGTATGGATTAAGCA TGG (reversed) Intronic
901683072 1:10926827-10926849 CTGGAAGTTTGGTTTAAGGAGGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
907472690 1:54684502-54684524 CAGCAAGCATAGTTTAAGCATGG + Intronic
911268154 1:95767895-95767917 CGGAGAGAATGGATTAAGCAGGG + Intergenic
911883933 1:103273364-103273386 TTGAAAGTAAGGATTAAGGAGGG - Intergenic
913445628 1:118947710-118947732 CTGCAAGTATGGATTAAGCATGG - Intronic
915032659 1:152896844-152896866 CTGCATGTAGGGATGAGGCAAGG - Intergenic
915224395 1:154401948-154401970 CTGTAATTATTGATTAACCAGGG + Intergenic
917961037 1:180144862-180144884 CTGCATGTTTGGAGTAAGGAAGG - Intergenic
918925022 1:190772160-190772182 TTCCAAGTGTGGATTAAGAAAGG + Intergenic
921316775 1:213899189-213899211 GTGCAAGTATGTGCTAAGCATGG - Intergenic
922919475 1:229289892-229289914 CTGGAAGCATTGATTAAACATGG + Intronic
923855028 1:237837336-237837358 CTGCAAGTATGAGGAAAGCAGGG + Intergenic
924445519 1:244126512-244126534 ATGCAGGTATGGATGAAGTAAGG + Intergenic
1067349275 10:45461257-45461279 CTGCAAGTATGAGTTCATCATGG - Exonic
1068476531 10:57533723-57533745 CAGAAAGTGTGGATTAAGGAAGG + Intergenic
1071746391 10:88424316-88424338 CTGGAAGACTGGATGAAGCAAGG + Intronic
1078353969 11:10619518-10619540 CTGCAAGTATTCATTAAACACGG + Intronic
1078358005 11:10647200-10647222 GTGCGGGTATGGACTAAGCATGG + Intronic
1079125628 11:17716862-17716884 ATGGAAGTGTGGATTAGGCAGGG - Intergenic
1085009637 11:73129371-73129393 CTGTAAGTATGGACGAAGCTTGG - Intronic
1099992242 12:89736318-89736340 CAGCAAGTATATATTAAACATGG + Intergenic
1102946900 12:116997735-116997757 CTACAGGTATGGTTTCAGCAGGG - Intronic
1103929434 12:124441634-124441656 CCGCAAGTATGTATGAATCATGG + Intronic
1106094183 13:26628453-26628475 CAGCAAGTATGAATTAAGGTAGG + Intronic
1107842311 13:44471506-44471528 CTACAAGTAGAGATTAAGTATGG + Intronic
1111750628 13:92327246-92327268 CGGCAAGTTTGAATTAAGCAAGG - Intronic
1113018263 13:105853121-105853143 TAGCAAATATGGATTGAGCAAGG - Intergenic
1120029917 14:79629646-79629668 CTGCTAATAGGGAGTAAGCAGGG + Intronic
1120458413 14:84761536-84761558 TTCCAAATATGGATGAAGCAAGG + Intergenic
1125330587 15:38578356-38578378 CTGCAAGTATGGATCAAGATTGG + Intergenic
1125868744 15:43077926-43077948 CTGAAAGTATGGATAATGTATGG - Intronic
1130566227 15:84998231-84998253 CTGCAAGTATTGGTGAAGCTGGG + Intronic
1132173486 15:99688359-99688381 CTACAAGCATGGTTTAATCAGGG + Intronic
1133312410 16:4858174-4858196 CTGGAAGTAAGCCTTAAGCATGG + Intronic
1133610190 16:7426276-7426298 TTGCTAGTAAGGATTAAGCGGGG - Intronic
1138988997 16:62367566-62367588 TTGCCAGTTTGGATTAAGGATGG + Intergenic
1141460694 16:84177105-84177127 CTGCAAGTCTGGAGTCAGCCAGG - Intronic
1142991121 17:3731665-3731687 ATACAAATATGGAGTAAGCAAGG + Intronic
1143264109 17:5622851-5622873 GTGGAAGTATGGATAATGCAAGG - Intergenic
1143573673 17:7777183-7777205 CTGCAAGTATGGGCTAGGCCTGG + Intronic
1148921475 17:51038795-51038817 CTTCAAGTATTGTTAAAGCAAGG - Intronic
1149941285 17:60870189-60870211 GTGCAGTTATGAATTAAGCATGG - Intronic
1155713702 18:28913219-28913241 CTACAATTATGAATTAACCAAGG - Intergenic
1158447555 18:57534296-57534318 CTGTAAGTTTGGATTTAGCAGGG - Intergenic
925472592 2:4178899-4178921 CTACAAGAATGGATAATGCAGGG + Intergenic
926045243 2:9705042-9705064 CAGCAGGTAGGGATAAAGCAAGG + Intergenic
929575230 2:43047464-43047486 CTGCATGTCTGGATTTCGCAGGG + Intergenic
930335664 2:50042177-50042199 CTGCAAATATTGATTAATCTAGG + Intronic
935515117 2:104026819-104026841 CTGCCAGTGTGGGTGAAGCAGGG - Intergenic
936749197 2:115620371-115620393 CTGCAAGTGTGGAGTAAGATTGG + Intronic
938744166 2:134261165-134261187 CTTCAAGTCTGGATTGAGGAGGG + Intronic
938984800 2:136564343-136564365 CAGCAAGTTTTCATTAAGCAGGG - Intergenic
939193787 2:138947530-138947552 CTGCAAGTCAGGATTGAGTATGG - Intergenic
945654569 2:212607474-212607496 CAGCAAGAATGGCTGAAGCATGG - Intergenic
946737004 2:222764038-222764060 CTGTATGTATGGACTCAGCATGG - Intergenic
948130390 2:235596454-235596476 CTGCAGATTTGGATTCAGCAAGG + Intronic
1170316461 20:15046557-15046579 ATGCATGTATGTATTAAGAAAGG + Intronic
1178505300 21:33157678-33157700 CTGCAATTATGGTTGAGGCAGGG - Intergenic
1178736720 21:35159343-35159365 CTTCAAGAATGGATGAAACATGG + Intronic
1183701934 22:39456071-39456093 CAGCAAGGATGGATGAAGCTGGG + Intergenic
949399389 3:3649778-3649800 CTCCAAGTTTGCATTAAACAAGG + Intergenic
951057934 3:18169469-18169491 CTGAAAGTATGGCATATGCAGGG + Intronic
954670561 3:52289180-52289202 CAGCAAGTATGGACTGAGCAGGG - Intronic
956948695 3:74254524-74254546 CTGCAAGTAAAAAGTAAGCAAGG - Intergenic
960218270 3:115070575-115070597 CTGGAAGAATGGATTTACCATGG + Intronic
963318584 3:143787437-143787459 ATGCATGTATGTAGTAAGCAGGG - Intronic
963377476 3:144486986-144487008 CTAGAAGAATGAATTAAGCAAGG - Intergenic
969689814 4:8698264-8698286 CAGCAAGTATGGAATATCCAGGG - Intergenic
974875341 4:67697557-67697579 CAGGAAGAATAGATTAAGCAGGG - Intronic
975326681 4:73066627-73066649 CTGCCAGTACTGCTTAAGCAAGG + Intronic
977311167 4:95389150-95389172 CTGAAAGTATTTATAAAGCAGGG + Intronic
977627838 4:99207429-99207451 TTGGAGGTATGGATGAAGCAGGG - Exonic
978555769 4:109979057-109979079 ATGCAAGTATTGAATACGCAAGG - Intronic
980160882 4:129161062-129161084 CTGAAAGGATGGAGTAAGGAGGG - Intergenic
984274175 4:177589053-177589075 TTTCAAGTAAGAATTAAGCATGG - Intergenic
984795302 4:183654739-183654761 CTCCAAGTATGTAATAACCATGG - Intronic
995906426 5:117129321-117129343 TTGCAAGTAGGGATTTTGCAGGG - Intergenic
996693749 5:126369772-126369794 ATGCAGGTTTGGATTAAACAGGG - Intronic
1000195142 5:158949897-158949919 CTGGAAGTATGGATTGAGCTAGG - Intronic
1001011351 5:168101570-168101592 CTGCAAGTGTGCATTAGCCATGG + Intronic
1001724457 5:173885392-173885414 CTGGAAGTATGGAAGAAGGAAGG - Intergenic
1002994226 6:2268013-2268035 TTGCTTGTATGGATGAAGCATGG + Intergenic
1006037562 6:31225422-31225444 CTGCATGTATGCATTCAGCCAGG - Intergenic
1006974468 6:38085728-38085750 CTGCATGTATGGGCTGAGCACGG - Intronic
1008295979 6:49777826-49777848 CTGGAAGTGTGGATTGGGCAGGG + Intergenic
1009686358 6:66962682-66962704 CTGCAGGAATGGAATAATCAAGG + Intergenic
1014905870 6:127026135-127026157 CTGCAAGAATGGATGAATCCAGG - Intergenic
1016299543 6:142614850-142614872 CTTCAAGTATGGAAGAGGCAAGG - Intergenic
1018818613 6:167355604-167355626 CTGCAATTATAGTTTTAGCATGG - Intronic
1019476188 7:1245587-1245609 CTTCAAGGATGGAGGAAGCATGG - Intergenic
1026766429 7:73162810-73162832 AGGCAAGTATGCAGTAAGCATGG + Intergenic
1027042904 7:74972506-74972528 AGGCAAGTATGCAGTAAGCATGG + Intronic
1027080741 7:75229851-75229873 AGGCAAGTATGCAGTAAGCATGG - Intergenic
1029578094 7:101417280-101417302 CTGGAGGTATGGATGAAGAATGG + Intronic
1030934962 7:115574315-115574337 CTGGAAGTATGTTTTAATCAAGG + Intergenic
1033146326 7:138873458-138873480 CTATAAGTCTGGGTTAAGCAGGG - Intronic
1038880736 8:31608006-31608028 CAGCAATCAAGGATTAAGCAGGG + Intergenic
1040447612 8:47511565-47511587 CTGCAAGAGTGGATTCAGCCTGG - Intronic
1041521551 8:58762320-58762342 CTCCAAATATGGACCAAGCATGG - Intergenic
1041714647 8:60922634-60922656 CTGCGAGAATCCATTAAGCATGG - Intergenic
1043803047 8:84635713-84635735 CTGAAAGTATAGATTTAGAAGGG + Intronic
1047639040 8:126798625-126798647 GTTTAAGCATGGATTAAGCATGG - Intergenic
1055591923 9:77825549-77825571 CTGCTAATATGGAGTAAGCTGGG - Intronic
1055755370 9:79552152-79552174 CTGCCAGTCTGCATTCAGCAAGG + Intergenic
1059532425 9:115048139-115048161 CTACATTTATGGATTAAGTAGGG + Intronic
1195292633 X:103443944-103443966 ATGGAAGAATGGATGAAGCAGGG - Intergenic