ID: 913448004

View in Genome Browser
Species Human (GRCh38)
Location 1:118970368-118970390
Sequence TAGTATGCCCACAGTGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913448004_913448006 2 Left 913448004 1:118970368-118970390 CCACTGCCACTGTGGGCATACTA No data
Right 913448006 1:118970393-118970415 TGAGAGTTCACACTGAATCAAGG 0: 1
1: 0
2: 1
3: 15
4: 181
913448004_913448007 27 Left 913448004 1:118970368-118970390 CCACTGCCACTGTGGGCATACTA No data
Right 913448007 1:118970418-118970440 ACCTTTATCTTCTAAACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913448004 Original CRISPR TAGTATGCCCACAGTGGCAG TGG (reversed) Intronic
No off target data available for this crispr