ID: 913470380

View in Genome Browser
Species Human (GRCh38)
Location 1:119180379-119180401
Sequence GGGGTCCTAATGTGTCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913470380_913470387 0 Left 913470380 1:119180379-119180401 CCAACCAGACACATTAGGACCCC No data
Right 913470387 1:119180402-119180424 TCGGATAGTGACAGATCTGGAGG 0: 41
1: 67
2: 18
3: 16
4: 89
913470380_913470390 13 Left 913470380 1:119180379-119180401 CCAACCAGACACATTAGGACCCC No data
Right 913470390 1:119180415-119180437 GATCTGGAGGACGGTTGTCTGGG No data
913470380_913470391 18 Left 913470380 1:119180379-119180401 CCAACCAGACACATTAGGACCCC No data
Right 913470391 1:119180420-119180442 GGAGGACGGTTGTCTGGGACAGG No data
913470380_913470388 4 Left 913470380 1:119180379-119180401 CCAACCAGACACATTAGGACCCC No data
Right 913470388 1:119180406-119180428 ATAGTGACAGATCTGGAGGACGG No data
913470380_913470385 -3 Left 913470380 1:119180379-119180401 CCAACCAGACACATTAGGACCCC No data
Right 913470385 1:119180399-119180421 CCCTCGGATAGTGACAGATCTGG 0: 37
1: 69
2: 32
3: 7
4: 72
913470380_913470389 12 Left 913470380 1:119180379-119180401 CCAACCAGACACATTAGGACCCC No data
Right 913470389 1:119180414-119180436 AGATCTGGAGGACGGTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913470380 Original CRISPR GGGGTCCTAATGTGTCTGGT TGG (reversed) Intergenic
No off target data available for this crispr