ID: 913470385

View in Genome Browser
Species Human (GRCh38)
Location 1:119180399-119180421
Sequence CCCTCGGATAGTGACAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 37, 1: 69, 2: 32, 3: 7, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913470381_913470385 -7 Left 913470381 1:119180383-119180405 CCAGACACATTAGGACCCCTCGG No data
Right 913470385 1:119180399-119180421 CCCTCGGATAGTGACAGATCTGG 0: 37
1: 69
2: 32
3: 7
4: 72
913470379_913470385 0 Left 913470379 1:119180376-119180398 CCACCAACCAGACACATTAGGAC No data
Right 913470385 1:119180399-119180421 CCCTCGGATAGTGACAGATCTGG 0: 37
1: 69
2: 32
3: 7
4: 72
913470380_913470385 -3 Left 913470380 1:119180379-119180401 CCAACCAGACACATTAGGACCCC No data
Right 913470385 1:119180399-119180421 CCCTCGGATAGTGACAGATCTGG 0: 37
1: 69
2: 32
3: 7
4: 72
913470376_913470385 8 Left 913470376 1:119180368-119180390 CCAAGAACCCACCAACCAGACAC No data
Right 913470385 1:119180399-119180421 CCCTCGGATAGTGACAGATCTGG 0: 37
1: 69
2: 32
3: 7
4: 72
913470378_913470385 1 Left 913470378 1:119180375-119180397 CCCACCAACCAGACACATTAGGA No data
Right 913470385 1:119180399-119180421 CCCTCGGATAGTGACAGATCTGG 0: 37
1: 69
2: 32
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913470385 Original CRISPR CCCTCGGATAGTGACAGATC TGG Intergenic
901763993 1:11488428-11488450 CCCTTGGTGAGTGACAGCTCAGG - Intronic
902723959 1:18323031-18323053 CCCTTGGGTGGTGACAGATATGG - Intronic
903010013 1:20323115-20323137 CAGTCGGATGGTGACAGAGCTGG + Intronic
904891319 1:33781859-33781881 TGCTCAGATATTGACAGATCAGG + Intronic
905950466 1:41946446-41946468 CCCTCGGATAGTGACAGATCTGG - Intronic
906507167 1:46388851-46388873 CCCTTGGATAGTGATAGATCTGG + Intergenic
906583505 1:46955809-46955831 CCCTTGGATAGTGACAGATCTGG - Intergenic
907037464 1:51229064-51229086 TCCTCGGATAGTGACAGATCTGG - Intergenic
907505517 1:54915302-54915324 CCCTTGGATAGTGACAGATGTGG + Intergenic
907602455 1:55784828-55784850 CCCTCGAATAGTGACAGATCTGG + Intergenic
910591116 1:88928802-88928824 CCCTCGGATAGTGACAGATCTGG - Intergenic
912463841 1:109855720-109855742 CCCTTGGCTAGTGACAGATCTGG + Intergenic
913470385 1:119180399-119180421 CCCTCGGATAGTGACAGATCTGG + Intergenic
920425136 1:205869043-205869065 CCCTCAGATAGTGACAGATCTGG + Intergenic
921092727 1:211858592-211858614 CCCTCGGATAGTGACAGATCTGG - Intergenic
922073742 1:222221633-222221655 CCCCCAAATAGTGACAGAGCAGG - Intergenic
922684607 1:227629511-227629533 CCCTTGGATAGTGACAGATCTGG + Intronic
1065199489 10:23299634-23299656 CCCTTGGATAGTGACAGATCTGG + Intronic
1065825442 10:29566565-29566587 CCCTCGGGTAGAGAAAGTTCAGG - Intronic
1067431221 10:46247359-46247381 CCCTGGGTTAGGGACAGATCTGG + Intergenic
1067442192 10:46314868-46314890 CCCTGGGTTAGGGACAGATCTGG - Intronic
1068791736 10:61037220-61037242 CCCTCAGATAGTGACAGATCTGG + Intergenic
1071268385 10:83984483-83984505 CACTCTGAGAGTGACAGAACAGG - Intergenic
1071326935 10:84527206-84527228 CCCTCGGATAGTGACAGATCTGG + Intergenic
1072378020 10:94837633-94837655 CCCTTGGATAGTGACAGATCTGG + Intronic
1072471844 10:95720484-95720506 CCCTCGGATAGTGACAGATCTGG + Intronic
1079254875 11:18819303-18819325 CCCTCGGATAGTGACAAATCTGG + Intergenic
1079601234 11:22315198-22315220 CCCTCGGATAGTGACAGATCTGG + Intergenic
1079887233 11:26003617-26003639 CCCTCGGATAGTGACAGATCTGG - Intergenic
1079933649 11:26593420-26593442 CCCTTGGATAGTGACAGATCTGG + Intronic
1080772319 11:35353212-35353234 CCTTCTGATAGAGACAGATGGGG + Intronic
1085601691 11:77861359-77861381 CCCTTGGATAGTGACAGATCTGG + Intronic
1086441914 11:86836647-86836669 CCCTCGAATAGTGACAGATCTGG + Intronic
1088930738 11:114348591-114348613 CCCTTTGATGGTGACAGACCTGG + Intergenic
1091826080 12:3513998-3514020 CCCCCGGATACTGAAGGATCAGG + Intronic
1092294141 12:7184825-7184847 CCCTCAGATAGTGACAGATCTGG - Intergenic
1092469372 12:8764510-8764532 CTCTCGGATAGTGACAGATTTGG + Intronic
1093022932 12:14219696-14219718 CCCTTTGATGGTGACAGACCTGG - Intergenic
1093348643 12:18070271-18070293 CCCTCAGATAGTGACAGATCTGG - Intergenic
1095139049 12:38640122-38640144 CCCTCGGATAGTGACAGATCTGG - Intergenic
1095284004 12:40387898-40387920 CCCTCAGATAGAGACAGATCTGG - Intergenic
1096267704 12:50137084-50137106 CCCTGAGTTAGTGACAGATTAGG + Intronic
1097377184 12:58855374-58855396 CCCTCGGATAATGACAGATCTGG + Intergenic
1099605340 12:84796114-84796136 CCCTTGGATATTGACAGATCTGG - Intergenic
1103803174 12:123552808-123552830 CCCTCGGATAGTGACAGATCTGG - Intergenic
1104851465 12:131877014-131877036 GCCTCGGATAGTGACAGATCTGG + Intergenic
1108876754 13:55057992-55058014 CCCTAGGATAGTGACAGATCTGG - Intergenic
1109606659 13:64705989-64706011 CCCTCTAATAGTGACAGATCTGG + Intergenic
1111806262 13:93043116-93043138 CCCTCGGATAGTGACAGATCTGG - Intergenic
1113477331 13:110593560-110593582 CCATCTGATAATGACAGCTCTGG + Intergenic
1115897444 14:38105695-38105717 CCCTTTGATGGTGACAGATCTGG - Intergenic
1117198160 14:53361893-53361915 CCCTAGGATAGTGACAGATCTGG - Intergenic
1117672512 14:58123042-58123064 CCCTCGGATAGTGACAGATCTGG - Intronic
1125609050 15:40958613-40958635 TCCTGGGACAGTGGCAGATCTGG + Intergenic
1126700286 15:51360632-51360654 CCCTTTGATGGTGACAGACCTGG - Intronic
1126828926 15:52579449-52579471 CCCTCAGGGAATGACAGATCTGG + Intergenic
1127074212 15:55310219-55310241 CCCTCAGATAGTGACAGATCTGG + Intronic
1128362548 15:66972580-66972602 CCCTTGGATAGTGACAGATCTGG + Intergenic
1130354852 15:83119875-83119897 CCCTAGCATGGTGACAGCTCGGG + Intronic
1132679050 16:1132280-1132302 CCCTCCGCAGGTGACAGATCAGG + Intergenic
1135224808 16:20646535-20646557 CCCTTGGATAGTGACAGATCTGG - Intronic
1140039052 16:71393355-71393377 CCCTCCCATAGTGAGAGCTCTGG + Intergenic
1141341403 16:83206974-83206996 ACTTCGGAATGTGACAGATCTGG + Intronic
1142769036 17:2083502-2083524 TCTTAGGATAGTGACAGTTCTGG - Intronic
1144415201 17:15039749-15039771 CCCTCAGATAATGAGATATCAGG - Intergenic
1148826949 17:50400806-50400828 CCCTCGGATAGTGACAGATCTGG + Intergenic
1149274010 17:55014483-55014505 CCCTCGGATAGTGACAGATCTGG + Intronic
1151480635 17:74368459-74368481 CCCTCGGATACTCACAGCGCAGG - Intronic
1153133992 18:1892100-1892122 GCCTGGGATTCTGACAGATCTGG + Intergenic
1153401623 18:4688952-4688974 CCCTCGGATAGTGACAGATCTGG - Intergenic
1155343295 18:24834665-24834687 CTCTAGGATACTGTCAGATCTGG - Intergenic
1155898758 18:31361887-31361909 CCGTAGGATGGTGACAGATAAGG - Intergenic
1158785774 18:60710624-60710646 CCCTTGGATAGTGACAGATCTGG - Intergenic
1163900924 19:20099594-20099616 GCCTCAGATAGTGACAGATCTGG - Intronic
1164057424 19:21633460-21633482 CCCTCTGATAGTGACAGATCTGG - Intergenic
1164173636 19:22748988-22749010 CCCTCAGATAGTGACAGATCTGG - Intergenic
1164323065 19:24167989-24168011 CCCTTGGATAGTGACACATCTGG + Intergenic
1166165892 19:40988103-40988125 CCCTCGGATAGTAACAGATCTGG + Intergenic
924974062 2:157038-157060 CCCTCGGATAGTGACAGATCTGG + Intergenic
926864546 2:17343166-17343188 CGCTCAGATAGTGACAGATCTGG - Intergenic
928476531 2:31632652-31632674 CCCTCAGATAGTGACAGATCTGG - Intergenic
928677119 2:33661066-33661088 CCCTCAGATAGTGAAAGATCTGG - Intergenic
930390812 2:50759988-50760010 CCCTCGGAGAATTACAGCTCTGG + Intronic
930631624 2:53760000-53760022 CCCTCAGATAGTGACAGATCTGG - Intronic
931388050 2:61815019-61815041 CCCACAGATAGTGACTGATTTGG - Intergenic
932917752 2:75875975-75875997 CCCTCGGATAGTGACAGATCTGG - Intergenic
933175176 2:79166232-79166254 CCCTCGGATAGTGACAGATCTGG + Intergenic
933261013 2:80131590-80131612 CTCTCTAATAGTGACAAATCAGG + Intronic
933585580 2:84176379-84176401 CCCTCTGAGAGGGCCAGATCTGG + Intergenic
934671986 2:96220027-96220049 CCCTCAGATAGTGACAGATCTGG + Intergenic
935295089 2:101642231-101642253 GCCACGGATAGTAATAGATCTGG - Intergenic
935748765 2:106212260-106212282 TCCTCGGATAGTGACAGATCTGG - Intergenic
936387226 2:112041211-112041233 CCCTCGGATAGCGACAGATCTGG + Intergenic
939493573 2:142903528-142903550 CCCTTGGATAGTGACAGATCTGG + Intronic
942580346 2:177410645-177410667 CCCTCAGATAATGACAGATCTGG + Intronic
942816573 2:180059938-180059960 CCCTCAGATAGTGACAGATCTGG - Intergenic
942830869 2:180236585-180236607 CCCTCAGATAGTGACAGATCTGG - Intergenic
942853224 2:180515760-180515782 CACTGAGATAGTGACAGAGCTGG - Intergenic
943796175 2:191998850-191998872 CCATTGTATAGAGACAGATCTGG + Intronic
943938682 2:193961282-193961304 ACCTTGGATAATGACAGAACAGG + Intergenic
944039266 2:195336051-195336073 CCCTCGGATAGTGACAGATCTGG + Intergenic
945806480 2:214496468-214496490 CCCTTGTAGATTGACAGATCTGG - Intronic
945974373 2:216259167-216259189 CCCTGGGGTAGTGTCAGAGCGGG - Exonic
946107356 2:217383363-217383385 CCGTTGGATAGTGCCAGCTCTGG + Intronic
1168741323 20:193775-193797 CCCTTGGATAGTGACAGATCTGG + Intergenic
1168871649 20:1134657-1134679 CCCTGAGTTAGTGACAGAACTGG + Intronic
1170974563 20:21150125-21150147 CACTCTGGTAGTGACAGACCTGG - Intronic
1174977189 20:55349125-55349147 CCCTCGGATAGTGACAGATCTGG - Intergenic
1175030211 20:55945901-55945923 CCATGGGCTAGTGACAGAGCTGG + Intergenic
1177263430 21:18756261-18756283 TCCTCAGATAGTGACAGATCTGG + Intergenic
1177896340 21:26858983-26859005 CCCTCGGATAGTGACAGATCTGG - Intergenic
1178972734 21:37195285-37195307 CCCTGGGATGGAGACAGCTCTGG + Intronic
1179259052 21:39742349-39742371 CCCTCGGATAGTGACAGATCTGG + Intergenic
1180096594 21:45558186-45558208 CACACGGCTGGTGACAGATCAGG + Intergenic
1183355264 22:37355413-37355435 CCCTCTGCCAGTGACAGGTCAGG - Intergenic
951200603 3:19872498-19872520 CACTCAGATAGTGACAGATCTGG + Intergenic
951837946 3:27003210-27003232 CCCTCAGATAGTGACAGATCTGG - Intergenic
952922144 3:38292933-38292955 CCCTCGGATAGTGACAGATCTGG + Intronic
954096352 3:48331790-48331812 CCCTCGGATAGTGACAGATCTGG + Intergenic
955120740 3:56055668-56055690 CCCCCGGAGAGTGGCAGATTTGG - Intronic
956673902 3:71716726-71716748 CCATTGGTTAGTGGCAGATCTGG + Intronic
957000199 3:74875906-74875928 CCCTTAGATAGTGACAGATCAGG + Intergenic
958016172 3:87942307-87942329 CCCTCAGATAGTGACAGATCTGG + Intergenic
958629724 3:96670351-96670373 CCCTCAGATAGTGACAGATCTGG + Intergenic
960277559 3:115744975-115744997 CCCTCAGATAGTGACAGATCAGG - Intergenic
960539325 3:118846637-118846659 CCCTTTGATGGTGACAGACCTGG - Intergenic
962495529 3:135935810-135935832 CCCTCAGATAGTGATAGATCTGG - Intergenic
963188035 3:142440191-142440213 CCCTCGGATAGTGACAGATCTGG - Intronic
963915852 3:150858252-150858274 CCCTCAGATAGTGACAGATCTGG - Intergenic
964309334 3:155375993-155376015 TCCTCTGATAGTGGCAGAGCTGG - Intronic
964397886 3:156266395-156266417 CTCTGGGATAGTGACATAACTGG - Intronic
965054718 3:163697999-163698021 CCCTCAGACAGTGACAGACCTGG + Intergenic
965825240 3:172723118-172723140 CCCTTAGATAGTGACAGATCTGG - Intergenic
966353586 3:179056748-179056770 CCCTTGGATAGTGACAGATCTGG - Intronic
967623640 3:191662495-191662517 CCCTTGGATAGTGACAGATCTGG - Intergenic
967794611 3:193585948-193585970 CCATCGGTTATTGACAGTTCTGG + Intronic
968391088 4:193627-193649 CCCTTGGATAGTGACAGATCTGG + Intergenic
969645032 4:8423129-8423151 CCCTCGGGTAGTGACAGATCTGG - Intronic
971584320 4:28385849-28385871 CTCACCCATAGTGACAGATCAGG + Intronic
972781269 4:42288860-42288882 CCCTCGGATAGTGACAGATCTGG + Intergenic
974520551 4:62975921-62975943 CCCTCAGATAGTGACAGATATGG - Intergenic
976189925 4:82477930-82477952 CCCTCGGATAGTGACAGATCTGG - Intergenic
977617929 4:99106171-99106193 CCCTCAGATAGTGACAGATCTGG + Intergenic
978586718 4:110282277-110282299 CCCTCGGATAGTGACAGATCTGG + Intergenic
978909642 4:114048727-114048749 CCCTCGGATAGTGACAGATCTGG - Intergenic
980444288 4:132886049-132886071 CCCTCAGATAGTGACAGGTCTGG - Intergenic
983666945 4:170193288-170193310 CCCTTGGATAGTGATAGATTGGG + Intergenic
984723826 4:183001307-183001329 CCCTCGGATAGTGACAGATCTGG - Intergenic
987503437 5:18742825-18742847 CCCTTTGATGGTGACAGACCAGG + Intergenic
988457008 5:31395478-31395500 CCGTCGGATAGTGACAGATCTGG + Intergenic
988957098 5:36330940-36330962 ACCTCGGATAGTGACAGATCTGG + Intergenic
990355461 5:54962191-54962213 CCCAGAGATAGTGTCAGATCTGG + Intergenic
990892373 5:60662932-60662954 TCCTCGGATAGTGACAGATCTGG - Intronic
995465732 5:112447962-112447984 CCCTCAGACAGTGACAGATCTGG - Intergenic
1002821687 6:731346-731368 CCCTCGGATGGTGATTGATTTGG + Intergenic
1004024271 6:11803947-11803969 CACTGGGATACAGACAGATCTGG - Intronic
1004236900 6:13882299-13882321 CCCTCAGATAGTGACAGATCTGG - Intergenic
1005323578 6:24678794-24678816 CCCTCGGATAGTGACAGATCTGG + Intronic
1008582289 6:52918067-52918089 CCCTCGGATAGTGACAGATCTGG + Intergenic
1009544866 6:65008883-65008905 CCCTCGGATAGTGACAGATCTGG - Intronic
1009953157 6:70419633-70419655 CCCTCGGTTGGTCTCAGATCTGG + Intronic
1010893582 6:81341285-81341307 CCCTCAGATAGTGATAGATCCGG - Intergenic
1011076857 6:83447304-83447326 CCCTGGGATAGTGACAGATCCGG - Intergenic
1011189698 6:84716323-84716345 CCCTTGGATAGTGACAGATCTGG + Intronic
1011539772 6:88417242-88417264 CCCTTGGATAGTGACAGATGCGG + Intergenic
1012864881 6:104606980-104607002 CCTTCAGATAATGACAGGTCAGG - Intergenic
1013022321 6:106232258-106232280 CCCTTGGATAGTGACAGCTCTGG - Intronic
1013543631 6:111134978-111135000 TCCTGGGATAGTGACAGATATGG - Intronic
1015865400 6:137722019-137722041 CCCTCAGATAGTGACAGATCTGG + Intergenic
1016343164 6:143084042-143084064 CCCTCAGATAGTGACAGATCTGG + Intronic
1016444634 6:144119404-144119426 CCCTCGGATGGTGACAGATCTGG + Intergenic
1018687605 6:166316068-166316090 CCCTCGGATAGCGACAGATCTGG - Intergenic
1018691327 6:166346412-166346434 CCCTCAGATAGTGACAGATCTGG + Intergenic
1018761126 6:166895181-166895203 CCCTCGGAGAGTGACAGATCTGG - Intronic
1020508172 7:9019476-9019498 CCTCAAGATAGTGACAGATCTGG - Intergenic
1023439221 7:40169314-40169336 CCCTAGGATAGTGACAGATCTGG + Intronic
1024367654 7:48539548-48539570 TCCTCAGAAAGTGACAGATTAGG + Intronic
1026780892 7:73266555-73266577 CCCTGGGATGGTAACAGATGCGG - Intergenic
1026880054 7:73902183-73902205 CCCTATGATGGTGCCAGATCCGG - Intergenic
1027021746 7:74819997-74820019 CCCTGGGATGGTAACAGATGCGG - Exonic
1027066275 7:75125920-75125942 CCCTGGGATGGTAACAGATGCGG + Exonic
1027546377 7:79532035-79532057 GTCTCTGATACTGACAGATCAGG + Intergenic
1028588499 7:92473718-92473740 CCCTCAGATAGTGACAGATCTGG + Intronic
1030337378 7:108341380-108341402 CCCTCGGATAGTGACAGATGTGG - Intronic
1030843408 7:114382164-114382186 CCTTCGGACAGTGACAGATCTGG + Intronic
1031264641 7:119567743-119567765 CCCTCAGATAGTGACAGATTTGG - Intergenic
1031471613 7:122174582-122174604 CCCTCGGATAGTGACAGATCTGG - Intergenic
1032426015 7:131822687-131822709 CCCTCGGATACTGACAGATCTGG + Intergenic
1032725913 7:134590029-134590051 CCCTCGGACAGTGACAGAACTGG - Intergenic
1034249274 7:149675339-149675361 CCCTCAGATAGTGACAGATCTGG - Intergenic
1037571076 8:20158228-20158250 CTCTCAGATAGTGACAGATCTGG - Intronic
1037638067 8:20718364-20718386 CCCTCAAATAGAGACAGAGCTGG - Intergenic
1040527666 8:48239001-48239023 CCCTTGGATAGTGACAGATCTGG + Intergenic
1041386906 8:57313878-57313900 CACTGGGAGAGTAACAGATCAGG + Intergenic
1041663784 8:60423359-60423381 CCCTCGGATAGTGACAGATCTGG + Intergenic
1042056198 8:64766940-64766962 CCCTCGGATAGTGAGATATCTGG - Intronic
1043490052 8:80740083-80740105 CCTTTGGATAGTGACAGATCTGG - Intronic
1047241315 8:123091579-123091601 ACATCAGATACTGACAGATCAGG - Intronic
1047443796 8:124902009-124902031 CCCTTGGATTTTGACAGATCTGG + Intergenic
1051848680 9:21482528-21482550 CCCTAGAATAGTGATAGCTCTGG + Intergenic
1052528910 9:29656671-29656693 CTCTCGGATAGTGACAGATCTGG + Intergenic
1052538434 9:29777102-29777124 CCCTCAGATAGTGACAAATCTGG + Intergenic
1056704619 9:88941415-88941437 CCCTCAGATAGTGACAGTTCTGG + Intergenic
1059745011 9:117191803-117191825 CCACCGCATAGTGACAGATGAGG - Intronic
1059763990 9:117366011-117366033 GCCTTGGATAATGGCAGATCAGG - Intronic
1061303626 9:129720501-129720523 CCCTGGGCTGGTGACAGAGCAGG + Intronic
1186254165 X:7701449-7701471 CCCTTGGATAGTGACAGATCTGG + Intergenic
1189946620 X:46187010-46187032 CCCTTGGATAGTGACAGATCTGG - Intergenic
1191167010 X:57401987-57402009 CCCTTGGATAGTGACAGATCTGG + Intronic
1192939889 X:75901355-75901377 CCCTCGGATAGTGACAGATCTGG + Intergenic
1193171893 X:78346816-78346838 CCCTCGGATAGTGACAGACCTGG + Intergenic
1193306787 X:79960016-79960038 CCCTAGGATAGTGACAGATCTGG - Intergenic
1195535035 X:106001027-106001049 CCCTCGGATAGTGACAGATCAGG - Intergenic
1196527260 X:116740976-116740998 CCCTCTGATAGTGACAGATCTGG + Intergenic
1197760983 X:130028129-130028151 TCCTCGGAGAGTGACAAATGGGG + Intronic
1199907156 X:152244660-152244682 CCCACGGAGAGTGACACTTCTGG + Intronic
1201905660 Y:19083669-19083691 CCTTCTGATAGTGACAGATCTGG - Intergenic