ID: 913470387

View in Genome Browser
Species Human (GRCh38)
Location 1:119180402-119180424
Sequence TCGGATAGTGACAGATCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 41, 1: 67, 2: 18, 3: 16, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913470380_913470387 0 Left 913470380 1:119180379-119180401 CCAACCAGACACATTAGGACCCC No data
Right 913470387 1:119180402-119180424 TCGGATAGTGACAGATCTGGAGG 0: 41
1: 67
2: 18
3: 16
4: 89
913470376_913470387 11 Left 913470376 1:119180368-119180390 CCAAGAACCCACCAACCAGACAC No data
Right 913470387 1:119180402-119180424 TCGGATAGTGACAGATCTGGAGG 0: 41
1: 67
2: 18
3: 16
4: 89
913470381_913470387 -4 Left 913470381 1:119180383-119180405 CCAGACACATTAGGACCCCTCGG No data
Right 913470387 1:119180402-119180424 TCGGATAGTGACAGATCTGGAGG 0: 41
1: 67
2: 18
3: 16
4: 89
913470379_913470387 3 Left 913470379 1:119180376-119180398 CCACCAACCAGACACATTAGGAC No data
Right 913470387 1:119180402-119180424 TCGGATAGTGACAGATCTGGAGG 0: 41
1: 67
2: 18
3: 16
4: 89
913470378_913470387 4 Left 913470378 1:119180375-119180397 CCCACCAACCAGACACATTAGGA No data
Right 913470387 1:119180402-119180424 TCGGATAGTGACAGATCTGGAGG 0: 41
1: 67
2: 18
3: 16
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913470387 Original CRISPR TCGGATAGTGACAGATCTGG AGG Intergenic
905950464 1:41946443-41946465 TCGGATAGTGACAGATCTGGAGG - Intronic
906507169 1:46388854-46388876 TTGGATAGTGATAGATCTGGAGG + Intergenic
906583503 1:46955806-46955828 TTGGATAGTGACAGATCTGGAGG - Intergenic
907037462 1:51229061-51229083 TCGGATAGTGACAGATCTGGAGG - Intergenic
907505519 1:54915305-54915327 TTGGATAGTGACAGATGTGGAGG + Intergenic
907602457 1:55784831-55784853 TCGAATAGTGACAGATCTGGAGG + Intergenic
910591114 1:88928799-88928821 TCGGATAGTGACAGATCTGGAGG - Intergenic
911129640 1:94375476-94375498 TCAGATGGTAACAGATCTTGAGG + Intergenic
912463843 1:109855723-109855745 TTGGCTAGTGACAGATCTGGAGG + Intergenic
913382752 1:118228879-118228901 TCGGATGGTAACAGACCTTGAGG - Intergenic
913470387 1:119180402-119180424 TCGGATAGTGACAGATCTGGAGG + Intergenic
917086264 1:171308194-171308216 TCGGATGGTAACAGACCTTGAGG - Intergenic
917281299 1:173380105-173380127 TCGGATAGTAACGGACCTTGAGG - Intergenic
917445657 1:175104173-175104195 TCGGATGGTAACAGACCTTGAGG + Intronic
917845195 1:179014722-179014744 ACAGATAGTGCCACATCTGGGGG - Intergenic
920425138 1:205869046-205869068 TCAGATAGTGACAGATCTGGAGG + Intergenic
921092725 1:211858589-211858611 TCGGATAGTGACAGATCTGGAGG - Intergenic
922684609 1:227629514-227629536 TTGGATAGTGACAGATCTGGAGG + Intronic
1063321567 10:5056896-5056918 TCGGATGGTAACAGACCTTGAGG + Intronic
1063662727 10:8045150-8045172 TGTGAAACTGACAGATCTGGCGG - Intergenic
1064951672 10:20858057-20858079 TTGCAAAGTGACAGCTCTGGTGG + Intronic
1065199491 10:23299637-23299659 TTGGATAGTGACAGATCTGGAGG + Intronic
1068791738 10:61037223-61037245 TCAGATAGTGACAGATCTGGAGG + Intergenic
1071326937 10:84527209-84527231 TCGGATAGTGACAGATCTGGAGG + Intergenic
1072378022 10:94837636-94837658 TTGGATAGTGACAGATCTGGAGG + Intronic
1072471846 10:95720487-95720509 TCGGATAGTGACAGATCTGGAGG + Intronic
1072822968 10:98576597-98576619 TCTGACAGTGAGAGATGTGGAGG - Intronic
1074613178 10:115040386-115040408 TCGGATGGTAACAGACCTTGAGG - Intergenic
1079254877 11:18819306-18819328 TCGGATAGTGACAAATCTGGAGG + Intergenic
1079491927 11:20998540-20998562 TTGGATAATAACAGAACTGGAGG - Intronic
1079601236 11:22315201-22315223 TCGGATAGTGACAGATCTGGAGG + Intergenic
1079887231 11:26003614-26003636 TCGGATAGTGACAGATCTGGAGG - Intergenic
1079933651 11:26593423-26593445 TTGGATAGTGACAGATCTGGAGG + Intronic
1081070649 11:38605359-38605381 TCGGATAGTGACAGATCTAGAGG - Intergenic
1085601693 11:77861362-77861384 TTGGATAGTGACAGATCTGGAGG + Intronic
1086112754 11:83217474-83217496 TCGGATAGTAACAGACTTTGAGG + Intronic
1086441916 11:86836650-86836672 TCGAATAGTGACAGATCTGGAGG + Intronic
1088930740 11:114348594-114348616 TTTGATGGTGACAGACCTGGAGG + Intergenic
1089726607 11:120486051-120486073 TCGGATAGTGGCAGGGGTGGGGG + Exonic
1092123330 12:6059271-6059293 TCGGAAAGTGATAGATCCTGGGG - Intronic
1092469373 12:8764513-8764535 TCGGATAGTGACAGATTTGGAGG + Intronic
1093022930 12:14219693-14219715 TTTGATGGTGACAGACCTGGAGG - Intergenic
1093348641 12:18070268-18070290 TCAGATAGTGACAGATCTGGAGG - Intergenic
1094425039 12:30308463-30308485 TGGGGTAGTGCCAGGTCTGGTGG - Intergenic
1095139047 12:38640119-38640141 TCGGATAGTGACAGATCTGGAGG - Intergenic
1096351996 12:50908304-50908326 TTGGATGGTGACAGATGTGAAGG + Intergenic
1097377186 12:58855377-58855399 TCGGATAATGACAGATCTGGAGG + Intergenic
1099605338 12:84796111-84796133 TTGGATATTGACAGATCTGGAGG - Intergenic
1100209939 12:92389931-92389953 TTGGATAGTAACAGACCTTGGGG - Intergenic
1103283850 12:119784003-119784025 TCGGAGAGTGTCAGAGGTGGAGG - Exonic
1103803172 12:123552805-123552827 TCGGATAGTGACAGATCTGGAGG - Intergenic
1108848752 13:54703572-54703594 TCGGATGGTAACAGACCTTGAGG - Intergenic
1108876752 13:55057989-55058011 TAGGATAGTGACAGATCTGGAGG - Intergenic
1109606661 13:64705992-64706014 TCTAATAGTGACAGATCTGGAGG + Intergenic
1111806260 13:93043113-93043135 TCGGATAGTGACAGATCTGGAGG - Intergenic
1113551356 13:111195453-111195475 TCGGATGGTAACAGACCTTGAGG + Intronic
1114384388 14:22240620-22240642 TCGGATAGTGACAGATCTGAAGG - Intergenic
1115844427 14:37510908-37510930 TCGGAGAGTGAAAGGTGTGGTGG - Intronic
1115897442 14:38105692-38105714 TTTGATGGTGACAGATCTGGAGG - Intergenic
1117198158 14:53361890-53361912 TAGGATAGTGACAGATCTGGAGG - Intergenic
1117672510 14:58123039-58123061 TCGGATAGTGACAGATCTGGAGG - Intronic
1126700284 15:51360629-51360651 TTTGATGGTGACAGACCTGGAGG - Intronic
1127074214 15:55310222-55310244 TCAGATAGTGACAGATCTGGAGG + Intronic
1128362550 15:66972583-66972605 TTGGATAGTGACAGATCTGGAGG + Intergenic
1128811301 15:70574772-70574794 TTGGAAAGTGGCAGAGCTGGGGG + Intergenic
1128994169 15:72284785-72284807 TCAGATAGTAAAAGATGTGGGGG - Exonic
1130837306 15:87663639-87663661 GTGGATAGTTACAAATCTGGGGG + Intergenic
1133763004 16:8814642-8814664 ACGGCTAATGACAGAGCTGGTGG + Intronic
1135224806 16:20646532-20646554 TTGGATAGTGACAGATCTGGAGG - Intronic
1140507476 16:75482853-75482875 TCGGCTGGTGACAGAGCTGCTGG - Intronic
1147344614 17:39781212-39781234 TTGGGTAGTGCCACATCTGGTGG - Intronic
1148826951 17:50400809-50400831 TCGGATAGTGACAGATCTGGAGG + Intergenic
1149004463 17:51790458-51790480 TGGGAAAGTGACAGGTCAGGAGG - Intronic
1149209851 17:54289844-54289866 TCGGATGGTAACAGACCTTGAGG - Intergenic
1149274012 17:55014486-55014508 TCGGATAGTGACAGATCTGGAGG + Intronic
1151047670 17:70940804-70940826 TCTCATAGTGCCAGATCTGCTGG - Intergenic
1153401621 18:4688949-4688971 TCGGATAGTGACAGATCTGGAGG - Intergenic
1158785772 18:60710621-60710643 TTGGATAGTGACAGATCTGGAGG - Intergenic
1159657992 18:71055925-71055947 TGGGATAGAGACAGAGCTGAAGG - Intergenic
1162237293 19:9319379-9319401 TCGGATGGTAACAGACCTTGAGG + Intergenic
1163900922 19:20099591-20099613 TCAGATAGTGACAGATCTGGAGG - Intronic
1164057422 19:21633457-21633479 TCTGATAGTGACAGATCTGGAGG - Intergenic
1164173634 19:22748985-22749007 TCAGATAGTGACAGATCTGGAGG - Intergenic
1164323067 19:24167992-24168014 TTGGATAGTGACACATCTGGAGG + Intergenic
1164574892 19:29400290-29400312 GCGGATTCTGAAAGATCTGGGGG + Intergenic
1164992816 19:32696761-32696783 TCGGATGGTAACAGACCTTGAGG + Intronic
1165137331 19:33677869-33677891 CAGGATATTCACAGATCTGGTGG + Intronic
1165847232 19:38826040-38826062 TCGGATGGTAACAGACCTTGAGG - Intronic
1167100918 19:47403815-47403837 TAGGACAGAGACAGACCTGGAGG + Intronic
924974064 2:157041-157063 TCGGATAGTGACAGATCTGGAGG + Intergenic
926864545 2:17343163-17343185 TCAGATAGTGACAGATCTGGAGG - Intergenic
928428921 2:31201983-31202005 TCCCATAGTGCCAGAACTGGAGG + Exonic
928476529 2:31632649-31632671 TCAGATAGTGACAGATCTGGAGG - Intergenic
928677117 2:33661063-33661085 TCAGATAGTGAAAGATCTGGAGG - Intergenic
930631622 2:53759997-53760019 TCAGATAGTGACAGATCTGGAGG - Intronic
930821998 2:55655623-55655645 TCAGATAGTCACAGATTTTGAGG - Intronic
931472265 2:62550264-62550286 TAAGTTAGTGACAGATCTGGTGG - Intergenic
932917750 2:75875972-75875994 TCGGATAGTGACAGATCTGGAGG - Intergenic
933175178 2:79166235-79166257 TCGGATAGTGACAGATCTGGAGG + Intergenic
934671988 2:96220030-96220052 TCAGATAGTGACAGATCTGGAGG + Intergenic
935748763 2:106212257-106212279 TCGGATAGTGACAGATCTGGAGG - Intergenic
941243548 2:163070076-163070098 TCGGATGGTAACAGATCTTGAGG - Intergenic
941537425 2:166740839-166740861 TCGGATGGTAACAGAGCTTGAGG + Intergenic
941916360 2:170816421-170816443 TCGCAGGGTCACAGATCTGGGGG + Intronic
942580348 2:177410648-177410670 TCAGATAATGACAGATCTGGAGG + Intronic
942816571 2:180059935-180059957 TCAGATAGTGACAGATCTGGAGG - Intergenic
942830867 2:180236582-180236604 TCAGATAGTGACAGATCTGGAGG - Intergenic
943184030 2:184582215-184582237 TTGGATACAGACAGATTTGGTGG - Intergenic
944039268 2:195336054-195336076 TCGGATAGTGACAGATCTGGAGG + Intergenic
946107357 2:217383366-217383388 TTGGATAGTGCCAGCTCTGGAGG + Intronic
946966007 2:225038922-225038944 TCTCAAAGTGACAGATCTGATGG + Intronic
1168741325 20:193778-193800 TTGGATAGTGACAGATCTGGAGG + Intergenic
1170321061 20:15098567-15098589 TCGCATAGTGTTAGAGCTGGAGG - Intronic
1170974562 20:21150122-21150144 TCTGGTAGTGACAGACCTGGAGG - Intronic
1171261630 20:23739245-23739267 TCGGATGGTAACAGACCTTGAGG - Intergenic
1172594513 20:36141142-36141164 TCTGATATTGACAGATAAGGAGG - Intronic
1173107621 20:40152566-40152588 TTGGATAGGGACACATCTGGAGG + Intergenic
1174977187 20:55349122-55349144 TCGGATAGTGACAGATCTGGAGG - Intergenic
1177263432 21:18756264-18756286 TCAGATAGTGACAGATCTGGAGG + Intergenic
1177896338 21:26858980-26859002 TCGGATAGTGACAGATCTGGAGG - Intergenic
1179259054 21:39742352-39742374 TCGGATAGTGACAGATCTGGAGG + Intergenic
951200604 3:19872501-19872523 TCAGATAGTGACAGATCTGGAGG + Intergenic
951837944 3:27003207-27003229 TCAGATAGTGACAGATCTGGAGG - Intergenic
952553076 3:34500985-34501007 GCATATAGTGGCAGATCTGGAGG + Intergenic
952922146 3:38292936-38292958 TCGGATAGTGACAGATCTGGAGG + Intronic
954096354 3:48331793-48331815 TCGGATAGTGACAGATCTGGAGG + Intergenic
956842823 3:73156177-73156199 TCGGATGGTAACAGATCTTGAGG + Intergenic
957000201 3:74875909-74875931 TTAGATAGTGACAGATCAGGAGG + Intergenic
957445663 3:80310645-80310667 TCGGATAGTAACAGACTTTGAGG - Intergenic
958016174 3:87942310-87942332 TCAGATAGTGACAGATCTGGAGG + Intergenic
958629726 3:96670354-96670376 TCAGATAGTGACAGATCTGGAGG + Intergenic
960063816 3:113349842-113349864 TCGGATGGTAACAGACCTTGAGG - Intronic
960277557 3:115744972-115744994 TCAGATAGTGACAGATCAGGAGG - Intergenic
960354942 3:116640187-116640209 TCTGAAAGTGACAGATTAGGGGG - Intronic
960539323 3:118846634-118846656 TTTGATGGTGACAGACCTGGAGG - Intergenic
962495527 3:135935807-135935829 TCAGATAGTGATAGATCTGGAGG - Intergenic
963188033 3:142440188-142440210 TCGGATAGTGACAGATCTGGAGG - Intronic
963915850 3:150858249-150858271 TCAGATAGTGACAGATCTGGAGG - Intergenic
964916831 3:161850344-161850366 TCGGATAGTAACAGAGTTTGAGG + Intergenic
965054720 3:163698002-163698024 TCAGACAGTGACAGACCTGGAGG + Intergenic
966353584 3:179056745-179056767 TTGGATAGTGACAGATCTGGAGG - Intronic
967623638 3:191662492-191662514 TTGGATAGTGACAGATCTGGAGG - Intergenic
968391090 4:193630-193652 TTGGATAGTGACAGATCTGGAGG + Intergenic
969645030 4:8423126-8423148 TCGGGTAGTGACAGATCTGGAGG - Intronic
972161325 4:36231718-36231740 TGGGGTAGGGACAGATCAGGAGG - Intronic
972781271 4:42288863-42288885 TCGGATAGTGACAGATCTGGAGG + Intergenic
974520549 4:62975918-62975940 TCAGATAGTGACAGATATGGAGG - Intergenic
975004714 4:69270577-69270599 TCGGATAGTAACAGACTTTGGGG - Intergenic
975013134 4:69379557-69379579 TCGGATAGTAACAGACTTTGGGG - Intronic
975313729 4:72929620-72929642 TCGGATAGTGACAGATCTAGAGG + Intergenic
976189923 4:82477927-82477949 TCGGATAGTGACAGATCTGGAGG - Intergenic
977617931 4:99106174-99106196 TCAGATAGTGACAGATCTGGAGG + Intergenic
977834806 4:101634953-101634975 TCGGATGGTGACGGATCTTGAGG + Intronic
978586720 4:110282280-110282302 TCGGATAGTGACAGATCTGGAGG + Intergenic
978724413 4:111953777-111953799 TCAGATAGTCACAGAACTAGAGG - Intergenic
978909640 4:114048724-114048746 TCGGATAGTGACAGATCTGGAGG - Intergenic
979185138 4:117779737-117779759 TGGGAAACTGACAGATGTGGAGG - Intergenic
980444286 4:132886046-132886068 TCAGATAGTGACAGGTCTGGAGG - Intergenic
982701249 4:158661313-158661335 TCGGATGGTAACAGACCTTGAGG - Intergenic
983666947 4:170193291-170193313 TTGGATAGTGATAGATTGGGAGG + Intergenic
984723824 4:183001304-183001326 TCGGATAGTGACAGATCTGGAGG - Intergenic
984939675 4:184920076-184920098 TCGGATGGTAACAGACCTTGAGG + Intergenic
987130831 5:14858427-14858449 ACGCATAGTGCCAGATGTGGTGG + Intronic
987930009 5:24390490-24390512 TCGGATAGTTACAGACCTTGAGG - Intergenic
988457009 5:31395481-31395503 TCGGATAGTGACAGATCTGGAGG + Intergenic
988957100 5:36330943-36330965 TCGGATAGTGACAGATCTGGAGG + Intergenic
990892371 5:60662929-60662951 TCGGATAGTGACAGATCTGGAGG - Intronic
1000209720 5:159098159-159098181 TGGGACAGTGGGAGATCTGGTGG - Intronic
1004236898 6:13882296-13882318 TCAGATAGTGACAGATCTGGAGG - Intergenic
1005323580 6:24678797-24678819 TCGGATAGTGACAGATCTGGAGG + Intronic
1005351846 6:24943821-24943843 TCAAATAGTGACAGTTTTGGGGG - Intronic
1006405658 6:33843386-33843408 TCTGATACTCAGAGATCTGGGGG + Intergenic
1008582291 6:52918070-52918092 TCGGATAGTGACAGATCTGGAGG + Intergenic
1009544864 6:65008880-65008902 TCGGATAGTGACAGATCTGGAGG - Intronic
1010893580 6:81341282-81341304 TCAGATAGTGATAGATCCGGAGG - Intergenic
1011189700 6:84716326-84716348 TTGGATAGTGACAGATCTGGAGG + Intronic
1011344191 6:86351033-86351055 TCAGAAAGTCACAGATCTTGAGG + Intergenic
1011539774 6:88417245-88417267 TTGGATAGTGACAGATGCGGAGG + Intergenic
1013022319 6:106232255-106232277 TTGGATAGTGACAGCTCTGGAGG - Intronic
1013543629 6:111134975-111134997 TGGGATAGTGACAGATATGGAGG - Intronic
1013907737 6:115237815-115237837 TCGGATGGTAACAGACCTTGAGG + Intergenic
1015865402 6:137722022-137722044 TCAGATAGTGACAGATCTGGAGG + Intergenic
1016343166 6:143084045-143084067 TCAGATAGTGACAGATCTGGAGG + Intronic
1016444636 6:144119407-144119429 TCGGATGGTGACAGATCTGGAGG + Intergenic
1018557590 6:165064901-165064923 TCAGAAAGGGAGAGATCTGGAGG - Intergenic
1018687603 6:166316065-166316087 TCGGATAGCGACAGATCTGGAGG - Intergenic
1018691329 6:166346415-166346437 TCAGATAGTGACAGATCTGGAGG + Intergenic
1018761124 6:166895178-166895200 TCGGAGAGTGACAGATCTGGAGG - Intronic
1020209849 7:6150562-6150584 TCAAATACTGACACATCTGGAGG - Intronic
1020508171 7:9019473-9019495 CAAGATAGTGACAGATCTGGAGG - Intergenic
1021756614 7:23858767-23858789 TCGGATGGTAACAGACCTTGAGG + Intergenic
1022415120 7:30170814-30170836 TCACATGGTGACAGAGCTGGGGG + Intergenic
1023439223 7:40169317-40169339 TAGGATAGTGACAGATCTGGAGG + Intronic
1028588501 7:92473721-92473743 TCAGATAGTGACAGATCTGGAGG + Intronic
1030843409 7:114382167-114382189 TCGGACAGTGACAGATCTGGAGG + Intronic
1031471611 7:122174579-122174601 TCGGATAGTGACAGATCTGGAGG - Intergenic
1032426017 7:131822690-131822712 TCGGATACTGACAGATCTGGAGG + Intergenic
1032725911 7:134590026-134590048 TCGGACAGTGACAGAACTGGAGG - Intergenic
1037571075 8:20158225-20158247 TCAGATAGTGACAGATCTGGAGG - Intronic
1038638897 8:29308315-29308337 TCGGATGGTAACAGACCTTGAGG - Intergenic
1039877398 8:41598711-41598733 TCTGGTAGTGACAGATCTGCAGG + Exonic
1040527668 8:48239004-48239026 TTGGATAGTGACAGATCTGGAGG + Intergenic
1042056196 8:64766937-64766959 TCGGATAGTGAGATATCTGGAGG - Intronic
1043490051 8:80740080-80740102 TTGGATAGTGACAGATCTGGAGG - Intronic
1046721005 8:117619120-117619142 TGGCATTTTGACAGATCTGGAGG - Intergenic
1047443798 8:124902012-124902034 TTGGATTTTGACAGATCTGGAGG + Intergenic
1047807998 8:128379242-128379264 TTTGATGGTGACAGACCTGGAGG + Intergenic
1051248553 9:15136311-15136333 TCCAATACTGACAGATCTTGGGG - Intergenic
1051454259 9:17235868-17235890 ACAGAAAGTGACAGATTTGGAGG + Intronic
1051935380 9:22437878-22437900 TCGGATGGTAACAGACCTTGAGG - Intergenic
1052365084 9:27603279-27603301 TCAGATAGTCACCCATCTGGAGG - Intergenic
1052528911 9:29656674-29656696 TCGGATAGTGACAGATCTGGAGG + Intergenic
1052538436 9:29777105-29777127 TCAGATAGTGACAAATCTGGAGG + Intergenic
1056617284 9:88179275-88179297 TTGGATAGTCACAGCTGTGGTGG + Intergenic
1056704621 9:88941418-88941440 TCAGATAGTGACAGTTCTGGAGG + Intergenic
1060665267 9:125428811-125428833 TGGGATGATGACAGACCTGGAGG + Intergenic
1186254167 X:7701452-7701474 TTGGATAGTGACAGATCTGGAGG + Intergenic
1189946618 X:46187007-46187029 TTGGATAGTGACAGATCTGGAGG - Intergenic
1191167012 X:57401990-57402012 TTGGATAGTGACAGATCTGGAGG + Intronic
1192869909 X:75175427-75175449 TCGGATGGTAACGGATCTTGAGG + Intergenic
1192939891 X:75901358-75901380 TCGGATAGTGACAGATCTGGAGG + Intergenic
1193171895 X:78346819-78346841 TCGGATAGTGACAGACCTGGAGG + Intergenic
1193306785 X:79960013-79960035 TAGGATAGTGACAGATCTGGAGG - Intergenic
1194048324 X:89036176-89036198 CAGGATATTGACAGATCTGTGGG + Intergenic
1195535033 X:106001024-106001046 TCGGATAGTGACAGATCAGGAGG - Intergenic
1195735572 X:108009409-108009431 GAGGATAGTGGCAGATCTTGAGG + Intergenic
1196527262 X:116740979-116741001 TCTGATAGTGACAGATCTGGAGG + Intergenic
1197884877 X:131208167-131208189 TGGGATAGGGCCAGATTTGGAGG + Intergenic
1201724030 Y:17134523-17134545 TTGGATAGTGATGGATCTGAAGG + Intergenic
1201905659 Y:19083666-19083688 TCTGATAGTGACAGATCTGGAGG - Intergenic
1202089780 Y:21177691-21177713 TCAGATAGTAACAGACCTTGAGG + Intergenic