ID: 913470388

View in Genome Browser
Species Human (GRCh38)
Location 1:119180406-119180428
Sequence ATAGTGACAGATCTGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913470378_913470388 8 Left 913470378 1:119180375-119180397 CCCACCAACCAGACACATTAGGA No data
Right 913470388 1:119180406-119180428 ATAGTGACAGATCTGGAGGACGG No data
913470376_913470388 15 Left 913470376 1:119180368-119180390 CCAAGAACCCACCAACCAGACAC No data
Right 913470388 1:119180406-119180428 ATAGTGACAGATCTGGAGGACGG No data
913470381_913470388 0 Left 913470381 1:119180383-119180405 CCAGACACATTAGGACCCCTCGG No data
Right 913470388 1:119180406-119180428 ATAGTGACAGATCTGGAGGACGG No data
913470380_913470388 4 Left 913470380 1:119180379-119180401 CCAACCAGACACATTAGGACCCC No data
Right 913470388 1:119180406-119180428 ATAGTGACAGATCTGGAGGACGG No data
913470379_913470388 7 Left 913470379 1:119180376-119180398 CCACCAACCAGACACATTAGGAC No data
Right 913470388 1:119180406-119180428 ATAGTGACAGATCTGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913470388 Original CRISPR ATAGTGACAGATCTGGAGGA CGG Intergenic
No off target data available for this crispr