ID: 913470391

View in Genome Browser
Species Human (GRCh38)
Location 1:119180420-119180442
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913470383_913470391 -1 Left 913470383 1:119180398-119180420 CCCCTCGGATAGTGACAGATCTG 0: 33
1: 64
2: 25
3: 8
4: 62
Right 913470391 1:119180420-119180442 GGAGGACGGTTGTCTGGGACAGG No data
913470378_913470391 22 Left 913470378 1:119180375-119180397 CCCACCAACCAGACACATTAGGA No data
Right 913470391 1:119180420-119180442 GGAGGACGGTTGTCTGGGACAGG No data
913470381_913470391 14 Left 913470381 1:119180383-119180405 CCAGACACATTAGGACCCCTCGG No data
Right 913470391 1:119180420-119180442 GGAGGACGGTTGTCTGGGACAGG No data
913470380_913470391 18 Left 913470380 1:119180379-119180401 CCAACCAGACACATTAGGACCCC No data
Right 913470391 1:119180420-119180442 GGAGGACGGTTGTCTGGGACAGG No data
913470384_913470391 -2 Left 913470384 1:119180399-119180421 CCCTCGGATAGTGACAGATCTGG 0: 37
1: 66
2: 23
3: 15
4: 64
Right 913470391 1:119180420-119180442 GGAGGACGGTTGTCTGGGACAGG No data
913470376_913470391 29 Left 913470376 1:119180368-119180390 CCAAGAACCCACCAACCAGACAC No data
Right 913470391 1:119180420-119180442 GGAGGACGGTTGTCTGGGACAGG No data
913470379_913470391 21 Left 913470379 1:119180376-119180398 CCACCAACCAGACACATTAGGAC No data
Right 913470391 1:119180420-119180442 GGAGGACGGTTGTCTGGGACAGG No data
913470386_913470391 -3 Left 913470386 1:119180400-119180422 CCTCGGATAGTGACAGATCTGGA 0: 41
1: 65
2: 23
3: 16
4: 98
Right 913470391 1:119180420-119180442 GGAGGACGGTTGTCTGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr