ID: 913470780

View in Genome Browser
Species Human (GRCh38)
Location 1:119183097-119183119
Sequence GAGGGTTGGAAGTCAGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913470774_913470780 -9 Left 913470774 1:119183083-119183105 CCCTGCCAGATCCAGAGGGTTGG No data
Right 913470780 1:119183097-119183119 GAGGGTTGGAAGTCAGCTGCGGG No data
913470776_913470780 -10 Left 913470776 1:119183084-119183106 CCTGCCAGATCCAGAGGGTTGGA No data
Right 913470780 1:119183097-119183119 GAGGGTTGGAAGTCAGCTGCGGG No data
913470773_913470780 -8 Left 913470773 1:119183082-119183104 CCCCTGCCAGATCCAGAGGGTTG No data
Right 913470780 1:119183097-119183119 GAGGGTTGGAAGTCAGCTGCGGG No data
913470769_913470780 22 Left 913470769 1:119183052-119183074 CCTCGCTGGATCACAAGTGCAGC No data
Right 913470780 1:119183097-119183119 GAGGGTTGGAAGTCAGCTGCGGG No data
913470771_913470780 -5 Left 913470771 1:119183079-119183101 CCACCCCTGCCAGATCCAGAGGG No data
Right 913470780 1:119183097-119183119 GAGGGTTGGAAGTCAGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913470780 Original CRISPR GAGGGTTGGAAGTCAGCTGC GGG Intergenic
No off target data available for this crispr