ID: 913472069

View in Genome Browser
Species Human (GRCh38)
Location 1:119198135-119198157
Sequence GGGTTAATAAAGAAATAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913472065_913472069 -7 Left 913472065 1:119198119-119198141 CCCCTAAATAACCATTGGGTTAA No data
Right 913472069 1:119198135-119198157 GGGTTAATAAAGAAATAAAAAGG No data
913472066_913472069 -8 Left 913472066 1:119198120-119198142 CCCTAAATAACCATTGGGTTAAT No data
Right 913472069 1:119198135-119198157 GGGTTAATAAAGAAATAAAAAGG No data
913472067_913472069 -9 Left 913472067 1:119198121-119198143 CCTAAATAACCATTGGGTTAATA No data
Right 913472069 1:119198135-119198157 GGGTTAATAAAGAAATAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913472069 Original CRISPR GGGTTAATAAAGAAATAAAA AGG Intergenic
No off target data available for this crispr