ID: 913473052

View in Genome Browser
Species Human (GRCh38)
Location 1:119209379-119209401
Sequence CTAATTTATCAGATAACTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913473052_913473054 5 Left 913473052 1:119209379-119209401 CCAATAGTTATCTGATAAATTAG No data
Right 913473054 1:119209407-119209429 AACAAGCATATGGTTTAAATTGG No data
913473052_913473053 -5 Left 913473052 1:119209379-119209401 CCAATAGTTATCTGATAAATTAG No data
Right 913473053 1:119209397-119209419 ATTAGATGTAAACAAGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913473052 Original CRISPR CTAATTTATCAGATAACTAT TGG (reversed) Intergenic
No off target data available for this crispr