ID: 913473779

View in Genome Browser
Species Human (GRCh38)
Location 1:119217184-119217206
Sequence CTGGACAAGCAGAATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913473779_913473784 24 Left 913473779 1:119217184-119217206 CCATCATCATTCTGCTTGTCCAG No data
Right 913473784 1:119217231-119217253 TAAACATGTACCCCTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913473779 Original CRISPR CTGGACAAGCAGAATGATGA TGG (reversed) Intergenic
No off target data available for this crispr