ID: 913477539

View in Genome Browser
Species Human (GRCh38)
Location 1:119252887-119252909
Sequence ATGCTTCTCAACAAGCAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913477536_913477539 11 Left 913477536 1:119252853-119252875 CCATGGCTTTGCATAGTTAAGGA No data
Right 913477539 1:119252887-119252909 ATGCTTCTCAACAAGCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913477539 Original CRISPR ATGCTTCTCAACAAGCAGGC CGG Intergenic
No off target data available for this crispr