ID: 913478472

View in Genome Browser
Species Human (GRCh38)
Location 1:119261693-119261715
Sequence CTGTAACCATAGATGAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913478472_913478475 -7 Left 913478472 1:119261693-119261715 CCCATCCTCATCTATGGTTACAG No data
Right 913478475 1:119261709-119261731 GTTACAGTGTAAGCTCCTGAAGG No data
913478472_913478480 22 Left 913478472 1:119261693-119261715 CCCATCCTCATCTATGGTTACAG No data
Right 913478480 1:119261738-119261760 CCTGTGTTGTACTCAGTCCTTGG No data
913478472_913478476 -6 Left 913478472 1:119261693-119261715 CCCATCCTCATCTATGGTTACAG No data
Right 913478476 1:119261710-119261732 TTACAGTGTAAGCTCCTGAAGGG No data
913478472_913478477 -1 Left 913478472 1:119261693-119261715 CCCATCCTCATCTATGGTTACAG No data
Right 913478477 1:119261715-119261737 GTGTAAGCTCCTGAAGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913478472 Original CRISPR CTGTAACCATAGATGAGGAT GGG (reversed) Intergenic
No off target data available for this crispr