ID: 913482733

View in Genome Browser
Species Human (GRCh38)
Location 1:119304375-119304397
Sequence CACGATAATCCCCTTGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913482731_913482733 -4 Left 913482731 1:119304356-119304378 CCGTATCACTTTTGGTCCTCACG No data
Right 913482733 1:119304375-119304397 CACGATAATCCCCTTGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913482733 Original CRISPR CACGATAATCCCCTTGAGAT AGG Intergenic
No off target data available for this crispr