ID: 913484561

View in Genome Browser
Species Human (GRCh38)
Location 1:119322069-119322091
Sequence AACGGCATAGTTCAGTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913484553_913484561 18 Left 913484553 1:119322028-119322050 CCCAGGATCTGCAGTCAGCAAGC No data
Right 913484561 1:119322069-119322091 AACGGCATAGTTCAGTCTGAAGG No data
913484554_913484561 17 Left 913484554 1:119322029-119322051 CCAGGATCTGCAGTCAGCAAGCT No data
Right 913484561 1:119322069-119322091 AACGGCATAGTTCAGTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913484561 Original CRISPR AACGGCATAGTTCAGTCTGA AGG Intergenic
No off target data available for this crispr