ID: 913486478

View in Genome Browser
Species Human (GRCh38)
Location 1:119336283-119336305
Sequence GCTGCTCCTGTTCACCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913486478_913486482 23 Left 913486478 1:119336283-119336305 CCTGCATGGTGAACAGGAGCAGC No data
Right 913486482 1:119336329-119336351 TATAAGGCCAGCTGGACCCCAGG No data
913486478_913486484 27 Left 913486478 1:119336283-119336305 CCTGCATGGTGAACAGGAGCAGC No data
Right 913486484 1:119336333-119336355 AGGCCAGCTGGACCCCAGGGTGG No data
913486478_913486483 24 Left 913486478 1:119336283-119336305 CCTGCATGGTGAACAGGAGCAGC No data
Right 913486483 1:119336330-119336352 ATAAGGCCAGCTGGACCCCAGGG No data
913486478_913486481 15 Left 913486478 1:119336283-119336305 CCTGCATGGTGAACAGGAGCAGC No data
Right 913486481 1:119336321-119336343 AAGAGTTTTATAAGGCCAGCTGG No data
913486478_913486480 7 Left 913486478 1:119336283-119336305 CCTGCATGGTGAACAGGAGCAGC No data
Right 913486480 1:119336313-119336335 ATGAGTGAAAGAGTTTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913486478 Original CRISPR GCTGCTCCTGTTCACCATGC AGG (reversed) Intergenic
No off target data available for this crispr