ID: 913491526

View in Genome Browser
Species Human (GRCh38)
Location 1:119384367-119384389
Sequence GAGAATCCTGAACTTCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913491526 Original CRISPR GAGAATCCTGAACTTCATGG TGG (reversed) Intronic
900823882 1:4910965-4910987 GAGAATCCTCAAGATGATGGGGG - Intergenic
903221460 1:21871980-21872002 GATAAACCTCAACTTCATGGTGG - Intronic
903319343 1:22532936-22532958 TAGAATCCTGAGCTCCATCGTGG + Intergenic
904032712 1:27543216-27543238 GAGAATCCTGAACACCTTGGAGG + Intronic
906996868 1:50805489-50805511 GAAAATCATGACATTCATGGTGG + Intronic
907171301 1:52467855-52467877 GAGAATCCTGAATAACATGAAGG - Intronic
908776941 1:67649592-67649614 GAGAATGCCGCACATCATGGAGG - Intergenic
909199626 1:72674036-72674058 GAGAATACTGCACATGATGGGGG - Intergenic
909959519 1:81822790-81822812 TAAATTCCTAAACTTCATGGAGG + Intronic
912387706 1:109280478-109280500 GGGAAACAGGAACTTCATGGGGG + Exonic
913341282 1:117760128-117760150 GAGGAACCTAAACCTCATGGTGG + Intergenic
913391853 1:118322636-118322658 AAGCATCCTCAACTGCATGGAGG - Intergenic
913491526 1:119384367-119384389 GAGAATCCTGAACTTCATGGTGG - Intronic
914921329 1:151849575-151849597 CAGAATTGTGAAATTCATGGTGG - Intronic
916331562 1:163623808-163623830 CACAATCCTAAACTTCTTGGTGG + Intergenic
916359801 1:163955796-163955818 AAGTATTCTGAACTTGATGGTGG + Intergenic
918479645 1:184964761-184964783 GAGAATACTGAAATTCATGGTGG + Intronic
920815746 1:209330083-209330105 AAGATTCCTAAGCTTCATGGGGG + Intergenic
923378639 1:233392265-233392287 GTGAATCCAGAACTTCATCTGGG - Intergenic
923632551 1:235661441-235661463 GTGAATCCTGAGGTCCATGGAGG - Exonic
1063051320 10:2452402-2452424 GAGACTCCTGAACTGGATGTTGG - Intergenic
1066058253 10:31700971-31700993 GAGGCACCTGAACTTCCTGGAGG + Intergenic
1066247045 10:33593599-33593621 GAGAATGCAGAGCTTCTTGGTGG - Intergenic
1068043605 10:51858451-51858473 GAAAATCCTGAACTTTATTCAGG - Intronic
1070553507 10:77510442-77510464 GAGAAACCTGCACTCCATAGAGG - Intronic
1070914975 10:80147787-80147809 GAAAATCCTGAACAACATGCTGG - Intergenic
1070989246 10:80716903-80716925 AAGAAACCTGAAGTTGATGGTGG - Intergenic
1071564067 10:86662588-86662610 GAGGATTACGAACTTCATGGGGG - Intronic
1074387278 10:113026659-113026681 AAGAAGGCTGAACTTAATGGAGG - Intronic
1074690219 10:115997673-115997695 GAAAAATCTGAACTTCATAGTGG + Intergenic
1078033269 11:7775555-7775577 GACAAGCCTGAAGTCCATGGTGG + Intergenic
1078118103 11:8476132-8476154 CAGAATCCTGATCTTCTTTGGGG + Intronic
1080343167 11:31293026-31293048 GAGAAATCTGAAATTCAGGGAGG - Intronic
1081846265 11:46242866-46242888 GGGCATCCAGAACTTCTTGGTGG - Intergenic
1082193536 11:49274521-49274543 GAGTATACTGGACTTCATGATGG + Intergenic
1083814451 11:65124721-65124743 GAGAGTCCAGAGCCTCATGGGGG - Intronic
1083828827 11:65218146-65218168 GTGATTCCTCAGCTTCATGGTGG + Intergenic
1086672602 11:89566667-89566689 GAGTATACTGGACTTCATGATGG - Intergenic
1089342172 11:117765398-117765420 GAGGATCCAGACCCTCATGGTGG - Intronic
1090834613 11:130445144-130445166 GAGAAGCGAGAACTCCATGGCGG + Intergenic
1090851647 11:130575893-130575915 GAGAATCCTGAAATTGCTGCTGG - Intergenic
1091909782 12:4220254-4220276 GAGAATCAAAAACTTCATGAGGG + Intergenic
1095354061 12:41250473-41250495 AAGTATCTTGAACTTGATGGAGG - Intronic
1098667983 12:73188355-73188377 GAGAATCTTAAACTACAGGGTGG + Intergenic
1099211821 12:79800333-79800355 GAGAATTCTGACCTTTATGATGG + Intronic
1101839232 12:108316042-108316064 GAGGATTATGAACTTCCTGGGGG - Intronic
1105913661 13:24893662-24893684 GGGAAACCTGATATTCATGGAGG - Intronic
1106823576 13:33492920-33492942 GAGAAAGCTGAGTTTCATGGAGG + Intergenic
1107017769 13:35721460-35721482 GAGAACACTGATCTTCGTGGAGG - Intergenic
1107222454 13:38001111-38001133 AAGCATCTTGAACTTGATGGAGG + Intergenic
1107780263 13:43893294-43893316 GAGAAAACTGAGCTTCATTGAGG + Exonic
1110288087 13:73773179-73773201 GTGAGCCCTGAGCTTCATGGAGG + Intronic
1111047498 13:82833740-82833762 GACATTCCAGAACTTCATGTAGG - Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1114949156 14:27725597-27725619 GAGAATTCTGAACTTTGTGTGGG + Intergenic
1116245922 14:42412002-42412024 CAGGAACCTGAACATCATGGTGG - Intergenic
1117182348 14:53203659-53203681 CATAATCCTAAACTTCCTGGAGG - Intergenic
1117240836 14:53830674-53830696 TAGAATCCTAAATTTCTTGGAGG - Intergenic
1117378143 14:55134489-55134511 AACAATCTTGAACTTCAAGGTGG - Intronic
1118593208 14:67416840-67416862 GAGAAGCCTCACCTTTATGGTGG - Intergenic
1119460019 14:74793909-74793931 GAGAATCCTGACCTTCTCTGAGG + Intronic
1119896420 14:78223648-78223670 GAGCACCCTGAACTCCATGGAGG + Intergenic
1120540415 14:85743746-85743768 GAGATTCCTGAGCTCCATGCTGG + Intergenic
1121488138 14:94336065-94336087 GTGAATCTTCAACTGCATGGAGG - Intergenic
1121952921 14:98187644-98187666 GAGGATCCTGGATTTCTTGGTGG + Intergenic
1125029047 15:35057970-35057992 GAGGATCCTGAAGTTCTTGTGGG + Intergenic
1126458578 15:48891275-48891297 GAGAACGTTGAACTTCAAGGTGG + Intronic
1127530314 15:59837344-59837366 GAAAAACCTGGACTTCAAGGTGG + Intergenic
1128379579 15:67102659-67102681 TAGAATTCTGAACCTCTTGGTGG + Intronic
1128790349 15:70428771-70428793 GAGAATCCTGAAGTTCAGAGAGG + Intergenic
1129620506 15:77139907-77139929 GAGAATGCTAAGCTTCAAGGCGG + Intronic
1130857407 15:87853005-87853027 GAGAAAACTGAACTTCAAAGAGG - Intergenic
1132385511 15:101397526-101397548 GAGAAGCCTGGACTTCCTGCTGG + Intronic
1133389163 16:5395281-5395303 GAAGAGCCTGAACTTCCTGGAGG - Intergenic
1134893715 16:17864804-17864826 GAGAAAACTGATATTCATGGAGG - Intergenic
1136470910 16:30479404-30479426 GAAAATTCTGGACTTCATGAAGG + Exonic
1137663569 16:50232629-50232651 GAGAATCCTGCACGTCACGGTGG - Intronic
1137739432 16:50753293-50753315 GAGAATTGTGGCCTTCATGGAGG + Intronic
1139366779 16:66438555-66438577 GCGAATGAGGAACTTCATGGTGG - Intronic
1140179235 16:72697504-72697526 GAGAATCCTACACTGGATGGAGG + Intergenic
1142249756 16:88985904-88985926 GAGAAAGCTGAAGGTCATGGAGG + Intergenic
1146942246 17:36851409-36851431 GAGAATCCCGAAGTTCAGAGAGG - Intergenic
1146972157 17:37082048-37082070 GAGAAACCTGACCTGCATTGAGG + Intergenic
1148120259 17:45205326-45205348 GACAATCCTAAAATTCATGTGGG - Intergenic
1149123105 17:53193991-53194013 GAGAAACCTGAAGTTTATGCTGG - Intergenic
1151378319 17:73707163-73707185 GAGAAACCTCATCTTCCTGGGGG - Intergenic
1156946425 18:42838554-42838576 GAGAAAACTGAAATTCAAGGAGG + Intronic
1158343961 18:56495919-56495941 GAGAATGCTGAGCTTCATTTGGG - Intergenic
1160772760 19:840485-840507 GAGAATCCTGGCCTTAAAGGGGG + Intergenic
1161375225 19:3936515-3936537 GAGCACCCTGACCTTCTTGGGGG + Intronic
1162284991 19:9731509-9731531 GAGCAGCCTGAACTTGATGCAGG - Intergenic
926546898 2:14252719-14252741 GAGAATGAAGAACTTCATGATGG + Intergenic
927125401 2:20008693-20008715 GAGAAACCTGAGGTTCAAGGAGG + Intronic
928184756 2:29100553-29100575 TGGAATTGTGAACTTCATGGGGG - Intronic
928508419 2:31978473-31978495 GAGAATCCAGAAACTCATGCTGG + Intronic
930199014 2:48534957-48534979 AAGAATCCCGAATTCCATGGAGG + Intronic
931834772 2:66086767-66086789 CATAATCCTAAACTTCTTGGAGG - Intergenic
932437665 2:71712211-71712233 GGGAAGCCTTAACTTCCTGGGGG + Intergenic
933844012 2:86310604-86310626 GAGAATCTTGATCTTTAGGGTGG - Intronic
937572589 2:123382007-123382029 CAAAATCCTGTACTTCTTGGAGG - Intergenic
939646269 2:144702888-144702910 GAGAAAACTGAGGTTCATGGAGG + Intergenic
939760642 2:146173141-146173163 CAAAATCCCTAACTTCATGGAGG + Intergenic
940578136 2:155541243-155541265 GAGAATTCTGTGCTTCATGTGGG + Intergenic
942686544 2:178538749-178538771 GAGAAACCTGAATGTGATGGTGG - Exonic
942689037 2:178565706-178565728 GAGAAACCTGAACATGATGGCGG - Exonic
943654401 2:190492137-190492159 CATAATCCTAAACTTCTTGGAGG - Intronic
943829078 2:192435820-192435842 GAGGAAAATGAACTTCATGGAGG + Intergenic
943966702 2:194343409-194343431 AAGAATGCTGTACTTCATAGTGG + Intergenic
944703220 2:202264079-202264101 GACAAGCCTGACCATCATGGAGG + Intergenic
947460642 2:230301128-230301150 CATAATCCTAAACTTCGTGGAGG - Intronic
948557220 2:238821702-238821724 CAGAGCCCTGAACTTCAGGGAGG - Intergenic
948659608 2:239498958-239498980 GGGAAACCTGAACTACACGGAGG + Intergenic
1169688953 20:8308673-8308695 GAGAAAACTGAAATACATGGAGG + Intronic
1175031297 20:55957013-55957035 GGGAATCATGAACAGCATGGAGG + Intergenic
1175311094 20:58012019-58012041 GATCATCCTGACCTTCAGGGTGG + Intergenic
1179961737 21:44771326-44771348 GAGAATGCTGAGCTGCTTGGCGG + Exonic
1181851665 22:25754110-25754132 GAGAATTCTGGCCTTCATAGGGG + Intronic
1182908193 22:33956871-33956893 GAAAGTCCTTGACTTCATGGTGG + Intergenic
1184951818 22:47848515-47848537 GAGAATCCTGAAGTTCTGAGTGG - Intergenic
950687833 3:14631523-14631545 GAGGATGCTGAACCACATGGAGG - Intergenic
951325982 3:21302499-21302521 CATAATCCCAAACTTCATGGAGG - Intergenic
951613277 3:24516241-24516263 GAGGATCCTAAATTTCATGAAGG + Intergenic
954674394 3:52307780-52307802 CAGCCTCCTGAACTTCCTGGCGG - Intergenic
956329901 3:68094695-68094717 GAGAATACTGAGGCTCATGGGGG - Intronic
961138682 3:124536925-124536947 GAGAATCCACATCTTCATGCAGG + Intronic
964880756 3:161420056-161420078 GAAAGTGCTGACCTTCATGGAGG + Intergenic
965060921 3:163785242-163785264 CAGAATCCCAAACTTCTTGGAGG + Intergenic
967471231 3:189864450-189864472 CAGAATCTTGACCTTCAAGGAGG - Intronic
968316304 3:197728721-197728743 GAGAATTCAGAACGTAATGGGGG + Intronic
970371092 4:15407358-15407380 GAGAATCCTGAAATTCAGGGAGG + Intronic
971204590 4:24552526-24552548 GAGATTACTCAATTTCATGGAGG + Intronic
971554828 4:28001111-28001133 CAGAATCCCAAACTTCTTGGAGG + Intergenic
972420189 4:38879454-38879476 GAGAATTCTTCACTTCATAGAGG - Intronic
973342928 4:49025011-49025033 CATAATCCTGAACTTCTTGGAGG + Intronic
973988038 4:56374831-56374853 GAGAAAACTGAAGTTCATGGAGG + Intronic
977907454 4:102494459-102494481 TAGATTCCTGAATTTCATGCCGG - Intergenic
978683598 4:111413633-111413655 CATAATCCTGGACTTCATAGAGG + Intergenic
978705140 4:111699030-111699052 GGGAGTACTGAACTTCATGATGG - Intergenic
979833331 4:125328757-125328779 GAGAATACTGAGGCTCATGGAGG + Intronic
983422031 4:167531458-167531480 GAGAATTCTGAACATGTTGGGGG + Intergenic
983715254 4:170775232-170775254 GAATATCCAGGACTTCATGGTGG + Intergenic
984229344 4:177075351-177075373 GAGATTCCTTAACTTCAGAGAGG - Intergenic
985829414 5:2217111-2217133 GACACTCTTGACCTTCATGGAGG + Intergenic
986748408 5:10763393-10763415 GAGAATCCTGAAATTAATACTGG + Intergenic
987095201 5:14543260-14543282 GAGAATCCTGGAATTCATCAAGG - Intergenic
987902026 5:24024493-24024515 CACAATCCTCAACTTCTTGGGGG - Intronic
990431064 5:55736336-55736358 ATGAATCCTGAAATTCTTGGTGG + Intronic
991558717 5:67925253-67925275 GAGAATACTGAAATTCATGGCGG - Intergenic
992333382 5:75740671-75740693 TAGAATCCTGAATTTGTTGGGGG + Intergenic
993597270 5:89873572-89873594 CAGAATCCTGAAATTAATGATGG + Intergenic
996195765 5:120605210-120605232 GATAATCCTGTATTTCTTGGAGG + Intronic
997241561 5:132311927-132311949 GAGGATCCTGAGTTTCAGGGAGG + Intronic
999943994 5:156575264-156575286 GAGAACCCTGCAGTTCAAGGAGG - Intronic
1000216085 5:159157992-159158014 GAGACTCTTGAACTTTATGACGG - Intronic
1001177026 5:169479920-169479942 CATAATCCTAAACTTCTTGGAGG + Intergenic
1001565657 5:172697593-172697615 GAAAGTCCTGAAGTTCAGGGAGG + Intergenic
1002290477 5:178197017-178197039 GAAGAAGCTGAACTTCATGGAGG + Intergenic
1002316160 5:178345002-178345024 GAGTATCCTCAGCTTCATGAGGG - Intronic
1003440460 6:6136627-6136649 AAGATTCCTAAACTTCATAGAGG - Intergenic
1003628557 6:7765876-7765898 GAGAAATCTGAACTTGAAGGAGG - Intronic
1005245060 6:23873952-23873974 GAGAATGCTTAATTGCATGGAGG + Intergenic
1008892851 6:56515385-56515407 GAGAATCATGATTTTTATGGTGG - Intronic
1009360154 6:62801848-62801870 TAGAATCCCAAACTCCATGGAGG + Intergenic
1014860413 6:126460232-126460254 GAGAATCCTGAATTACATTTGGG + Intergenic
1015199828 6:130566724-130566746 GAGAAGCCTCACCATCATGGTGG + Intergenic
1016909999 6:149189447-149189469 CAGAATCCCAAACTTCTTGGAGG + Intergenic
1018464319 6:164029343-164029365 AAGAAAACTGAACTTCTTGGTGG - Intergenic
1020480329 7:8651767-8651789 GAGAATCATCAACTGCCTGGTGG + Intronic
1026423982 7:70271049-70271071 GAGAAGCCTGAACTCCGGGGTGG - Intronic
1028491668 7:91419176-91419198 GAGAAAACTGAAATTCAAGGTGG - Intergenic
1031348542 7:120699585-120699607 GAAATTCCTGACCTTCTTGGGGG - Intronic
1031964470 7:128017738-128017760 GCGAAGCCTGAACTTCCAGGAGG + Intronic
1032123167 7:129171414-129171436 GAGATTCATGATCTTCATGGGGG - Intergenic
1032850896 7:135794186-135794208 GAGAAAACCGAACTTCATGGAGG - Intergenic
1033120513 7:138663769-138663791 GTGAAGCCTGAACTTCTTGAAGG - Intronic
1034144846 7:148860463-148860485 GAGAATACAGAACTTCATTGAGG + Intronic
1035095323 7:156349583-156349605 GATAATCGTGAAGATCATGGTGG + Intergenic
1039642492 8:39238902-39238924 CATAATCCCAAACTTCATGGAGG - Intronic
1040442693 8:47461306-47461328 CAGAATCCCAAACTTCTTGGAGG + Intronic
1040652505 8:49464982-49465004 GACAAGCCTGAACAACATGGAGG + Intergenic
1041673230 8:60513987-60514009 GAAAATCCTGTTCTTCAAGGTGG + Intergenic
1042450855 8:68943752-68943774 AACAATCCTGAACTACATGTTGG + Intergenic
1045953421 8:107878357-107878379 GAGAAACCTGAGGTTCATTGTGG + Intergenic
1046330756 8:112712200-112712222 GAGGATCCTGCTCTTCATAGTGG - Intronic
1046407637 8:113794982-113795004 CAGAATCCTGAACTTGATCCTGG + Intergenic
1048236726 8:132698284-132698306 GAGAAACCTGAATTTCAGAGAGG + Intronic
1050133476 9:2438198-2438220 CATAATCCTAAACTTCTTGGAGG + Intergenic
1050851549 9:10293545-10293567 GAGTATCCTAAACTTAATGATGG - Intronic
1059316337 9:113428884-113428906 TGGAATCCTGAAATTCATTGGGG - Exonic
1186880259 X:13858303-13858325 GAGAATTATGAACTTCAGAGAGG - Intronic
1186951217 X:14627609-14627631 GAGAATTCAGAACTAGATGGAGG - Intronic
1188040395 X:25365260-25365282 CATAATCCTGGACTTCTTGGAGG + Intergenic
1189866572 X:45336071-45336093 GAGAATGCTAAAATTCATGGAGG + Intergenic
1190662191 X:52665011-52665033 GACCATCCTGAACAACATGGTGG + Intronic
1192386110 X:70672468-70672490 GAGGAACTGGAACTTCATGGTGG - Intronic
1193720262 X:84977545-84977567 GATAATCCTGAAGTTCATGGAGG + Intergenic
1194298920 X:92161676-92161698 CATAATCCTAAACTTCTTGGAGG + Intronic
1197184520 X:123571479-123571501 CATAATCCTAAACTTCCTGGAGG - Intergenic
1198563578 X:137879990-137880012 GAGAATCCAGAACATACTGGTGG - Intergenic
1198997346 X:142588781-142588803 GAGAAACCTGAGCTTCAGTGGGG + Intergenic
1200181022 X:154150773-154150795 CAGCTTCTTGAACTTCATGGTGG - Exonic
1200186665 X:154187887-154187909 CAGCTTCTTGAACTTCATGGTGG - Intergenic
1200192317 X:154225025-154225047 CAGCTTCTTGAACTTCATGGTGG - Exonic
1200198072 X:154262829-154262851 CAGCTTCTTGAACTTCATGGTGG - Exonic
1200616525 Y:5386513-5386535 CATAATCCTAAACTTCTTGGAGG + Intronic