ID: 913494239

View in Genome Browser
Species Human (GRCh38)
Location 1:119413226-119413248
Sequence GCAAAGGTGTGTGATGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 3, 1: 0, 2: 1, 3: 12, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913494232_913494239 29 Left 913494232 1:119413174-119413196 CCCTGAAGGTCATGGGGGTCTGT 0: 1
1: 0
2: 0
3: 12
4: 128
Right 913494239 1:119413226-119413248 GCAAAGGTGTGTGATGCACCTGG 0: 3
1: 0
2: 1
3: 12
4: 116
913494233_913494239 28 Left 913494233 1:119413175-119413197 CCTGAAGGTCATGGGGGTCTGTA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 913494239 1:119413226-119413248 GCAAAGGTGTGTGATGCACCTGG 0: 3
1: 0
2: 1
3: 12
4: 116
913494237_913494239 -4 Left 913494237 1:119413207-119413229 CCAGCATCTGATATGGCAGGCAA 0: 1
1: 0
2: 0
3: 10
4: 97
Right 913494239 1:119413226-119413248 GCAAAGGTGTGTGATGCACCTGG 0: 3
1: 0
2: 1
3: 12
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913494239 Original CRISPR GCAAAGGTGTGTGATGCACC TGG Intergenic
900413626 1:2525186-2525208 GCAAACATGTCAGATGCACCAGG + Intronic
901237178 1:7673376-7673398 GAGGAGGTGTGTGAAGCACCTGG + Intronic
902321438 1:15669960-15669982 GGAAAGGGGTGTTATGTACCAGG + Intergenic
902716460 1:18276156-18276178 GCAAAGGTGGGTGCTGAACAGGG + Intronic
903265912 1:22157816-22157838 GTGAAAGTGTGTGAAGCACCCGG + Intergenic
913494239 1:119413226-119413248 GCAAAGGTGTGTGATGCACCTGG + Intergenic
913496972 1:119436838-119436860 GCAAAGGCCTGCGATGCACCTGG + Intergenic
913504594 1:119505002-119505024 GCAAAGGCATGCGATGCACCTGG + Intergenic
913510936 1:119561460-119561482 GCAAAGGTGTGTGATGCACCTGG + Intergenic
913515158 1:119598866-119598888 GCAAAGGTGTGTGATGCACCTGG + Intergenic
915978859 1:160407986-160408008 GAAAAGGTGAGTAATGCCCCTGG - Intronic
916014912 1:160741411-160741433 GGAAAGGTGTGTGGTGAAGCGGG + Intronic
919789879 1:201284140-201284162 GCAAGGATGGGTGATTCACCGGG + Intronic
921510026 1:216016769-216016791 GCAAATGTGTTGGAGGCACCAGG - Intronic
1064666337 10:17656058-17656080 GCCAAGGTGGGTGAGTCACCAGG + Intronic
1065556372 10:26919685-26919707 GCCAAGGTGGGTGACTCACCAGG + Intergenic
1070518408 10:77229163-77229185 GCAAAGGTGGGTCATCCACCTGG + Intronic
1071413864 10:85422933-85422955 GCCAAGGTGGGTGAATCACCAGG + Intergenic
1072519253 10:96215791-96215813 GCAATGGTGTGTATTGCATCTGG - Intronic
1077509854 11:2952821-2952843 GCCCAGGTGGGTGATGCATCTGG - Intronic
1081575729 11:44317584-44317606 GCAAAGGAGTGTGATGGCCAGGG + Intergenic
1082096925 11:48138446-48138468 GCAAATGTGGGTGTTGCACTAGG + Intronic
1083331309 11:61899718-61899740 GCAGAGCTGTGAGATGAACCGGG + Intronic
1084042648 11:66551249-66551271 GCGCAGGTGTGAGTTGCACCAGG - Exonic
1088583327 11:111335719-111335741 GCCAAGGTTTCTGCTGCACCTGG + Intergenic
1090083797 11:123633321-123633343 GCAAAAGTGTGTCATGAACTTGG - Exonic
1096740128 12:53687148-53687170 GCAAATGTGTGCAAAGCACCTGG + Intergenic
1106665744 13:31848500-31848522 GTAAAGGGGTCTGATGCACCAGG - Intergenic
1110690199 13:78423732-78423754 TCAGAGGTATTTGATGCACCAGG - Intergenic
1111985822 13:95066087-95066109 GCACATGTGTGTTATTCACCTGG + Intronic
1113455286 13:110444270-110444292 GCATAGGTGTGTGATGCTCGTGG + Intronic
1113765816 13:112880542-112880564 GCAGAGGGGTGTGAAGCACAAGG + Intronic
1114568115 14:23647207-23647229 GCAAAGGGTAGTGAAGCACCAGG - Intergenic
1118978702 14:70699130-70699152 GCAGATGTGAGTGATGCCCCAGG + Intergenic
1119578335 14:75750143-75750165 GGAAAGCTGTATGATGCAGCAGG - Intronic
1119585354 14:75829169-75829191 GAAAAGGTGTGAGTTGAACCTGG + Intronic
1124009203 15:25822484-25822506 GCAAAGGTGTGTCAGGACCCTGG - Intronic
1124356445 15:28998730-28998752 GCAGACGTGTGTTATGGACCAGG + Intronic
1125184622 15:36916191-36916213 GCAAAGGTGTGTGGATCACGAGG + Intronic
1126773617 15:52081019-52081041 GCAAAGGTACGGGATGAACCTGG + Intergenic
1137982984 16:53085462-53085484 GGAAGGGTGTGTGATGTACCAGG - Intronic
1140801687 16:78494279-78494301 ACAAAGGTGTGTGCTGCATAGGG - Intronic
1141143898 16:81515642-81515664 GCAAATGTGTATCCTGCACCAGG + Intronic
1142143960 16:88484976-88484998 GCACAGGTGTCTGCAGCACCTGG - Intronic
1148983683 17:51601757-51601779 GCAAAGTTGAGGGATGCACAGGG + Intergenic
1151347972 17:73514909-73514931 GCTCAGGTGTGTGGTCCACCAGG - Intronic
1152888083 17:82864484-82864506 GCCAGGGTGTGTCATACACCTGG + Intronic
1153988727 18:10376358-10376380 GCAAAGGTGTGAGAGCCATCGGG + Intergenic
1154197096 18:12274642-12274664 GCAAAGGCGTGTGATTCACCAGG - Intronic
1157234163 18:45947626-45947648 GCAAAGGTGTGTGCGGGAGCTGG - Intronic
1158397979 18:57094716-57094738 GTAAAGGTGAGGGATGCACTGGG - Intergenic
1160276524 18:77442672-77442694 GCAAGAGTGTGTGATGGAGCTGG - Intergenic
1162095533 19:8307758-8307780 GCAAAGGTGCGAGAGGCACCAGG + Intronic
1163595414 19:18218498-18218520 GCCAGGGTCTGTGATGGACCAGG - Exonic
1165320878 19:35084439-35084461 GTCAAAGTGTGTGATGCCCCCGG - Intergenic
1165484634 19:36088248-36088270 GCAATGGCGTGAGATGCCCCCGG - Intronic
1167247291 19:48381301-48381323 GCAAAGGTGGGCTTTGCACCTGG - Intergenic
929482665 2:42325474-42325496 GTCAAGGTGTGTGATGTAGCTGG - Exonic
933109261 2:78376354-78376376 GCCAAGGTGTGTGGATCACCTGG - Intergenic
937496617 2:122426989-122427011 GCAAAAGTGTGTGATGCGTTTGG - Intergenic
939574838 2:143883401-143883423 GCAGAGGTCTGAGGTGCACCAGG - Intergenic
941293699 2:163709121-163709143 TCAAAGTTATGTGATGCACGTGG - Intronic
942384123 2:175423413-175423435 GGAAAGGTGTGTACTGCTCCAGG - Intergenic
945429038 2:209743060-209743082 GCAAAGGTGTTTCAATCACCAGG + Intergenic
947918775 2:233852104-233852126 GGAAAGATGTGTGATCCTCCAGG + Intronic
1168853910 20:995488-995510 GCAGAGGTGTTTGATGCAGGAGG + Intronic
1172394356 20:34589583-34589605 GCCAAGGTGGGTGATTCACGAGG - Intronic
1173161529 20:40656250-40656272 GCCAAGGTGTGTGGATCACCTGG - Intergenic
1174240666 20:49132102-49132124 GCAGAGGTGTGGGAAGGACCTGG + Intronic
1174543909 20:51310798-51310820 GCAAAAGTGTCTGTTGCACAGGG + Intergenic
1175156339 20:56974115-56974137 GCAAAGGTGTGTGCTGGGCGAGG - Intergenic
1178596564 21:33959006-33959028 TCAACAGTGTGTGATGCATCTGG - Intergenic
1179648347 21:42789902-42789924 GCCAAGGTGGGTGAATCACCTGG + Intergenic
1180836840 22:18934191-18934213 GCACAGGTCTGTGAGGCACCCGG - Intronic
1184082169 22:42230113-42230135 GGAAAGCTGTGTGGTACACCTGG - Intronic
1185140951 22:49100939-49100961 GAGAAGGTGTGTGCTGCAACTGG - Intergenic
1203286933 22_KI270734v1_random:159490-159512 GCACAGGTCTGTGAGGCACCCGG - Intergenic
950210056 3:11116609-11116631 GCAAAGGTGTGTTATTGAGCAGG - Intergenic
953042838 3:39270005-39270027 GCACAGCTGGGTGAAGCACCTGG + Intronic
953716723 3:45322155-45322177 GCCCAGGTGTGTGCTGCACTTGG + Intergenic
958926187 3:100159883-100159905 GCAAAGGCATTTGATGCAGCTGG + Intronic
960952696 3:123009995-123010017 GAAAAGGTGCCTGATTCACCCGG + Intronic
961467413 3:127090200-127090222 AGAGAGGTGTATGATGCACCAGG - Intergenic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
968960526 4:3740972-3740994 GCCCAGGTGTGTGGTGCTCCTGG - Intergenic
969122518 4:4920524-4920546 GCCAAGGTGTGTGGGGCAGCTGG - Intergenic
969425939 4:7123840-7123862 CCAGAGGTGTGTGATGACCCGGG + Intergenic
974416199 4:61609931-61609953 CCAAAGATGTGTCATGCACAGGG + Intronic
985519977 5:369712-369734 GAACAGGTGTGTTCTGCACCAGG - Intronic
989418971 5:41213091-41213113 GCCAAGGTCAGTCATGCACCTGG - Intronic
991475112 5:67010774-67010796 GTGAAGGTGTGTGTTGCATCTGG + Intronic
995836751 5:116407063-116407085 TAAAAGATGTGTGTTGCACCTGG + Intronic
997778136 5:136629733-136629755 GCAACTGTGTGTGATGAATCAGG - Intergenic
998609190 5:143669483-143669505 TGAAAGATGTGTGATGTACCTGG - Intergenic
999245722 5:150153591-150153613 TCCAAGGTGTGTGAAGTACCAGG + Intronic
999397520 5:151239498-151239520 TCAACGGTGTGTGAGGCGCCGGG + Intronic
999576047 5:152978597-152978619 GCAAAGGTGTCTGATAAAGCAGG - Intergenic
1001262827 5:170246771-170246793 GCAACTGTGACTGATGCACCTGG + Exonic
1003245643 6:4379803-4379825 GAAAAGGTGGGGGAAGCACCAGG + Intergenic
1005966162 6:30728127-30728149 TCAAAGGCTTGTGATTCACCTGG + Exonic
1016559803 6:145383240-145383262 GCAAAATTGTCTGATACACCTGG + Intergenic
1017560544 6:155623788-155623810 GCCAAGGTGGAAGATGCACCTGG + Intergenic
1017770579 6:157640950-157640972 GCATATGTGTATGATGCACACGG - Intronic
1019530549 7:1500875-1500897 GGAAAGGTGTGTGCTGGCCCTGG - Intronic
1023833981 7:44057854-44057876 GCAGAGGTGAGTGCTGCCCCGGG + Exonic
1024526526 7:50354269-50354291 GCAAAGGTGTGTCATCCAGTTGG + Intronic
1025191837 7:56901607-56901629 GCCAAGGTGTGTGGATCACCAGG - Intergenic
1025680113 7:63675324-63675346 GCCAAGGTGTGTGGATCACCAGG + Intergenic
1032418614 7:131759169-131759191 CCAAAGGTGTGTGATGCGAATGG + Intergenic
1035160149 7:156944230-156944252 GAAAAGCTCTGAGATGCACCTGG - Intergenic
1036569136 8:9964471-9964493 ACAAAGGAGTGGGATGCACCAGG - Intergenic
1037419923 8:18691078-18691100 TCAAAAGCGTGTGATGCTCCAGG - Intronic
1038584725 8:28778481-28778503 GCCCAGGTGTGAGATGCACCCGG + Intronic
1039555736 8:38473549-38473571 GAAAATGTGTGTAATGCACTTGG + Intergenic
1041679496 8:60574010-60574032 GCAAAGATGTGTGTTACACAAGG - Intronic
1043803348 8:84639709-84639731 ACCAAGGTGTATGATGGACCAGG - Intronic
1044528829 8:93284490-93284512 GAAAAGATGCTTGATGCACCTGG - Intergenic
1049246356 8:141564918-141564940 GAAAGGTTGGGTGATGCACCCGG + Intergenic
1053398494 9:37797566-37797588 ACAAATGTGTGTGTAGCACCTGG + Intronic
1053609711 9:39700166-39700188 TCAAAGGTGATTGTTGCACCAGG + Intergenic
1053867673 9:42457073-42457095 TCAAAGGTGATTGGTGCACCAGG + Intergenic
1054088540 9:60770992-60771014 TCAAAGGTGATTGTTGCACCAGG - Intergenic
1054243812 9:62642230-62642252 TCAAAGGTGATTGTTGCACCAGG - Intergenic
1055276620 9:74624601-74624623 CCAAAGGTCTGTGATGCAGCAGG - Intronic
1057194196 9:93107693-93107715 GGAAAGGCGTGTCCTGCACCAGG - Exonic
1059413505 9:114149121-114149143 GTATAGGTGTGTGGTGTACCAGG + Intergenic
1059449855 9:114363822-114363844 GCAAAGGTGTGGGCAGCATCAGG - Intronic
1060445924 9:123688082-123688104 GCAAAGGCATGTAATGCTCCTGG - Intronic
1061736099 9:132660391-132660413 GCAAGAGTGTGTGATACACTTGG - Intronic
1188244299 X:27821874-27821896 GCAAAGCTGAGTGATGAAACAGG + Exonic
1191892741 X:65961419-65961441 GAAAAGGTGTGTGAGGCATGTGG + Intergenic
1201726896 Y:17162547-17162569 GGAAAGATGTGTGATGCCTCTGG + Intergenic