ID: 913496531

View in Genome Browser
Species Human (GRCh38)
Location 1:119433043-119433065
Sequence TCACCTTACCCCACTGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913496531_913496535 3 Left 913496531 1:119433043-119433065 CCCCAGGCAGTGGGGTAAGGTGA No data
Right 913496535 1:119433069-119433091 ATGGAACACCCATTCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913496531 Original CRISPR TCACCTTACCCCACTGCCTG GGG (reversed) Intergenic
No off target data available for this crispr