ID: 913497829

View in Genome Browser
Species Human (GRCh38)
Location 1:119444673-119444695
Sequence CTGAGTAAACAATGGGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913497829_913497833 -8 Left 913497829 1:119444673-119444695 CCCACAACCCATTGTTTACTCAG No data
Right 913497833 1:119444688-119444710 TTACTCAGTGACTCCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913497829 Original CRISPR CTGAGTAAACAATGGGTTGT GGG (reversed) Intergenic
No off target data available for this crispr