ID: 913498849

View in Genome Browser
Species Human (GRCh38)
Location 1:119452270-119452292
Sequence CCTGATTTGCAGCAATGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913498844_913498849 5 Left 913498844 1:119452242-119452264 CCAGCAAAGCCAGGTACAGTGGA No data
Right 913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG No data
913498841_913498849 11 Left 913498841 1:119452236-119452258 CCTCACCCAGCAAAGCCAGGTAC No data
Right 913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG No data
913498838_913498849 17 Left 913498838 1:119452230-119452252 CCTTTCCCTCACCCAGCAAAGCC No data
Right 913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG No data
913498842_913498849 6 Left 913498842 1:119452241-119452263 CCCAGCAAAGCCAGGTACAGTGG No data
Right 913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG No data
913498840_913498849 12 Left 913498840 1:119452235-119452257 CCCTCACCCAGCAAAGCCAGGTA No data
Right 913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG No data
913498845_913498849 -4 Left 913498845 1:119452251-119452273 CCAGGTACAGTGGACATTGCCTG No data
Right 913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913498849 Original CRISPR CCTGATTTGCAGCAATGGCA GGG Intergenic
No off target data available for this crispr