ID: 913499865

View in Genome Browser
Species Human (GRCh38)
Location 1:119462222-119462244
Sequence ACATCAGAGGATCCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913499865_913499869 9 Left 913499865 1:119462222-119462244 CCCTTGAGGGGATCCTCTGATGT 0: 1
1: 0
2: 1
3: 12
4: 115
Right 913499869 1:119462254-119462276 CACCTTCTTGATGTTATATTTGG 0: 1
1: 0
2: 1
3: 17
4: 178
913499865_913499872 26 Left 913499865 1:119462222-119462244 CCCTTGAGGGGATCCTCTGATGT 0: 1
1: 0
2: 1
3: 12
4: 115
Right 913499872 1:119462271-119462293 ATTTGGCAGGTTTTTCCAGATGG 0: 8
1: 13
2: 10
3: 61
4: 442
913499865_913499871 13 Left 913499865 1:119462222-119462244 CCCTTGAGGGGATCCTCTGATGT 0: 1
1: 0
2: 1
3: 12
4: 115
Right 913499871 1:119462258-119462280 TTCTTGATGTTATATTTGGCAGG 0: 1
1: 0
2: 3
3: 24
4: 260
913499865_913499873 30 Left 913499865 1:119462222-119462244 CCCTTGAGGGGATCCTCTGATGT 0: 1
1: 0
2: 1
3: 12
4: 115
Right 913499873 1:119462275-119462297 GGCAGGTTTTTCCAGATGGCAGG 0: 3
1: 10
2: 10
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913499865 Original CRISPR ACATCAGAGGATCCCCTCAA GGG (reversed) Intergenic
902006782 1:13238447-13238469 ACATCAGGGTATCCACTCACTGG + Intergenic
902781164 1:18705877-18705899 AGCTCAGAGGCTCCCATCAAAGG + Intronic
904091331 1:27946937-27946959 AAATCAGAAGCTCCCCTCAAGGG - Intronic
905316974 1:37088746-37088768 ACATCACAGCATCCCCTGTAGGG + Intergenic
908375432 1:63533554-63533576 ACATCGAAGGGTCCCCTGAAAGG + Exonic
909888900 1:80978125-80978147 TCATCAGAGGAATCCCTCTAAGG + Intergenic
910870165 1:91826218-91826240 ACATTAGAGGGTCCCCTAGAAGG + Intronic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
911168024 1:94742475-94742497 GCAAAAGAGGATCCCCTCCAGGG - Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913499865 1:119462222-119462244 ACATCAGAGGATCCCCTCAAGGG - Intergenic
913510688 1:119558944-119558966 GCATCAGAGGGTCCCCATAAGGG - Intergenic
920665072 1:207957545-207957567 GCATCAGAGAATCTCCTGAAGGG + Intergenic
921182008 1:212638651-212638673 AAATCAGAGGCTCCCCTTACGGG + Intergenic
922814065 1:228436834-228436856 ACCACAGGGGATTCCCTCAAAGG - Intergenic
1066670393 10:37831638-37831660 ACATCAGAGAATTCACACAAGGG - Exonic
1072846743 10:98839771-98839793 ACATCTGTGGATCCCATAAATGG + Intronic
1081375691 11:42355440-42355462 AGAACAGAGGATCCCATGAAAGG + Intergenic
1083615545 11:64024357-64024379 AAATCATAGGACCCCCTCAACGG - Intronic
1091127789 11:133117365-133117387 CCATCACAGGTTCTCCTCAAGGG - Intronic
1096230859 12:49896052-49896074 ACATCAGGGGCGCCCCCCAAAGG - Intronic
1107701951 13:43057780-43057802 ACATCAAAGGATCACCCCATGGG - Intronic
1108729396 13:53217995-53218017 CCATCAGATAATCCCCTGAAAGG - Intergenic
1109116804 13:58398620-58398642 AAATCAAAGGCTCCGCTCAAAGG + Intergenic
1114694223 14:24611903-24611925 ACATCAAAGGATCACCCCATGGG - Intergenic
1121379591 14:93451540-93451562 ACATCAGAGGGTCTCCGGAATGG - Intronic
1122644932 14:103188028-103188050 ACACCAGAGGCTCCCCTAGAAGG + Intergenic
1127729009 15:61780954-61780976 ACATCAGGGAGTCCTCTCAAGGG + Intergenic
1128988996 15:72242664-72242686 ACAGCACAGGATGCCCTCCAAGG - Exonic
1129853614 15:78809994-78810016 TCATCAGCTGCTCCCCTCAACGG + Intronic
1132170164 15:99642759-99642781 TAATCAGAGGATCCTCTCAGAGG + Intronic
1132198285 15:99930357-99930379 ACACCTGAGGATCCCCTGGAGGG - Intergenic
1139259754 16:65580128-65580150 AGATTAGAGGAGCCCCTCGATGG + Intergenic
1140907856 16:79424975-79424997 GCATCAGAGTATACCTTCAAGGG - Intergenic
1142309333 16:89303200-89303222 ACATCACAGAAACACCTCAAAGG + Intronic
1143298716 17:5892575-5892597 ACACCAGAGGATCAACTCAATGG + Intronic
1143798679 17:9359427-9359449 AGTTCAGAGGAGCCCTTCAAGGG - Intronic
1145407908 17:22623741-22623763 ATATCAGAGGATCACTTCATTGG + Intergenic
1146118465 17:30165591-30165613 ACAGCAGAGGATACCCTCAAAGG + Intronic
1146267075 17:31459828-31459850 ACAACAGAGGAGCCCCTCTGGGG - Intronic
1146931757 17:36782818-36782840 ACATAAGAGAAGGCCCTCAAAGG - Intergenic
1151039665 17:70843969-70843991 ATATCAAAATATCCCCTCAAAGG - Intergenic
1152264432 17:79286158-79286180 ACGTCAGAGGGTCCTCACAAGGG - Intronic
1152644942 17:81464444-81464466 AGATCAGAGGGTGCCGTCAAGGG - Exonic
1162668348 19:12234357-12234379 ACATGCAAAGATCCCCTCAAGGG + Intronic
1163074841 19:14880705-14880727 AGAGCAAAGGATCCCCACAAGGG + Exonic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1165638319 19:37362749-37362771 ACATCAGAGGACACACTCAGGGG + Exonic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
1167816896 19:51890773-51890795 ACATAAGAGAATACACTCAAGGG - Exonic
929549151 2:42878472-42878494 AACTCAGAGCATCCCCTCACTGG + Intergenic
930235445 2:48884702-48884724 ACACCAGAGGATCCCTAAAAGGG + Intergenic
931418809 2:62106529-62106551 AGATCAGAGGAGACCCTGAATGG + Intronic
934750912 2:96793553-96793575 ACAGCAGTGGATCCCGCCAAGGG + Intronic
935639172 2:105274503-105274525 ACATCATAGCAGCCCCTCAGTGG - Intronic
938197367 2:129340408-129340430 ACAGCAGAGGTTCTACTCAAAGG + Intergenic
938923053 2:136012934-136012956 AGATGAGAGGCTCCCTTCAATGG - Intergenic
941402102 2:165044184-165044206 ACATCAAAGGATCACCACATGGG - Intergenic
941448913 2:165635196-165635218 AAATAAGAGGATGCCCTCACGGG - Intronic
944595952 2:201260719-201260741 ACATACGAGGATCACCTCCATGG - Intronic
945521577 2:210833937-210833959 ACATCAGGGGAACACCTCATGGG - Intergenic
947563421 2:231177797-231177819 TCATCTGAGGATCCCTTCATGGG + Intergenic
1168889338 20:1284117-1284139 GCACCAGAGGGTCCCCTCTAAGG - Intronic
1169039815 20:2483745-2483767 ACACCAGAGGATACACTCAGGGG - Exonic
1170813125 20:19690585-19690607 ACCTCCTAGAATCCCCTCAACGG - Intronic
1173401157 20:42727135-42727157 CCATCTGAGGTTCCCCACAATGG - Intronic
1173639767 20:44592710-44592732 GCTTCAGAGGCTCCTCTCAAAGG - Intronic
1173718299 20:45230637-45230659 ACATAAGAGGATCCAGACAATGG + Intergenic
1174289317 20:49496477-49496499 CCATCAGAGGGTCCCCACAGAGG + Intergenic
1176309772 21:5143264-5143286 AGATCAGAGCATCGCCTCAGTGG - Exonic
1179847285 21:44118769-44118791 AGATCAGAGCATCGCCTCAGTGG + Exonic
1180856387 22:19048530-19048552 ACATCTCAGGCTCCCCTCCATGG + Exonic
1181498769 22:23303444-23303466 ACATCAGAGACCCCCCTGAATGG - Intronic
950656424 3:14439830-14439852 ACCTCAGAGGACACCCTCCAGGG - Intronic
951467855 3:23021077-23021099 ACATCAAGGGATCCCCCCACGGG + Intergenic
952122799 3:30264567-30264589 ACATCAAAGGATTCCCTCATGGG + Intergenic
954088819 3:48268654-48268676 ACATCAGAGGACACACACAAGGG + Exonic
954088880 3:48269158-48269180 ACATCAGAGGATACACTCTGGGG + Exonic
954088936 3:48269578-48269600 ACATCAGAGGATACACTCGGGGG + Exonic
956786919 3:72650534-72650556 TGCTCAAAGGATCCCCTCAAAGG + Intergenic
963716026 3:148804943-148804965 AAGTGAGAGGATCCCCTCTAGGG - Intronic
964791753 3:160459883-160459905 AGCTCAGAGGATCCCCGCAGTGG + Intronic
966580264 3:181553662-181553684 ACATCAGCAGATCCCAGCAATGG - Intergenic
966941424 3:184750366-184750388 AAATCAGAGGATCCTTGCAAGGG - Intergenic
968292490 3:197549460-197549482 GCAGCAGGGGCTCCCCTCAAAGG + Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
971513733 4:27461048-27461070 ACATTAGAGGATCCCTCCAAGGG - Intergenic
974410826 4:61539278-61539300 ACAGCAGAGGCTCTCCTCACTGG - Intronic
976527916 4:86115183-86115205 GGATCAGAAGATCCCCTCATGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977993226 4:103469997-103470019 ACATCAGTGGATGCCTTCAAAGG + Intergenic
979357082 4:119716648-119716670 ACATCAAAGGATCACCTCGTGGG + Intergenic
986687788 5:10289330-10289352 ACCCCAGAGGATCCTCTCGAGGG + Intronic
990577605 5:57138228-57138250 GAATCAGAGGAGCCCTTCAAGGG - Intergenic
992347110 5:75890671-75890693 ACATCACAGGAGCCTCGCAATGG - Intergenic
993365955 5:87034708-87034730 ACATCAAAGAATCACCTCATGGG - Intergenic
997247894 5:132366729-132366751 ACATCACATGGACCCCTCAAAGG + Intergenic
997567719 5:134902472-134902494 ACATCAGTGGATCACATCACAGG - Intergenic
1005679187 6:28188733-28188755 ACATCACAGAATCCACTCAGGGG + Intergenic
1008838571 6:55869023-55869045 AGATCAGAGGAACCACTGAAAGG - Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1015665065 6:135619358-135619380 GCTTCAGAGGATCCTATCAAGGG - Intergenic
1019402119 7:861268-861290 ACATTAGAGCATCTTCTCAACGG - Intronic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1021963836 7:25898359-25898381 AGGTGAGAGGATCACCTCAAGGG - Intergenic
1024521751 7:50310885-50310907 ACTTCAGTGGAACCCCTCGAAGG + Intronic
1024792566 7:52983644-52983666 TCTTCAGAGGAACCCATCAAAGG - Intergenic
1029988769 7:104944313-104944335 CCATCTGGGGACCCCCTCAAAGG + Intergenic
1032136115 7:129279777-129279799 ACATCAGAAGTTACCCTAAAAGG - Intronic
1033606460 7:142931615-142931637 ACCTCAGAGGAGCCACTCATCGG - Intronic
1035311680 7:157973614-157973636 ACAGCAGAGGATGGCCTCACTGG + Intronic
1038321980 8:26535466-26535488 ACATCAGAGTATGACCTCTATGG - Intronic
1039569258 8:38574042-38574064 GCCTCAGAGAATCCCCTAAAGGG - Intergenic
1043104300 8:76089210-76089232 ACATCAAGGGATCACCCCAAGGG - Intergenic
1043537712 8:81225178-81225200 ACATCAAAGGATCACCCCATGGG - Intergenic
1046033796 8:108816914-108816936 ACATCAAGGGATCGCCTCATAGG - Intergenic
1046561987 8:115849337-115849359 ACATCAGAGGCTTCCATCTATGG - Intergenic
1047384254 8:124394972-124394994 ACATCAACGGAACACCTCAAGGG - Intergenic
1051758574 9:20434493-20434515 AAATCAGAGGATGTCTTCAAGGG + Intronic
1052307287 9:27024475-27024497 ACATCAAGGGATCACCTCATGGG + Intronic
1057685090 9:97225511-97225533 GCATCAAAGGATACCATCAAGGG + Intergenic
1060825660 9:126686501-126686523 ATATCAGATGATCCCCTGGAGGG + Intronic
1061059601 9:128243782-128243804 AGATCAGGGGACCCCCTCAGTGG - Intronic
1188134477 X:26477859-26477881 ACATCAGTGACTCCCTTCAAAGG + Intergenic
1189248012 X:39578530-39578552 CCATCAGAGGAACCCCTCATGGG - Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1194500630 X:94676863-94676885 ACTTCAGAGCAGCCCCTCTAAGG - Intergenic
1201906047 Y:19086616-19086638 ACATCAAAGGCACCCCTCACAGG + Intergenic