ID: 913503669

View in Genome Browser
Species Human (GRCh38)
Location 1:119496029-119496051
Sequence GAATTGGAAGGCTCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913503669_913503677 28 Left 913503669 1:119496029-119496051 CCCTTGAGGGAGCCTTCCAATTC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 913503677 1:119496080-119496102 ATTTGGCAGGTATTTTCTGATGG 0: 1
1: 1
2: 2
3: 38
4: 293
913503669_913503675 11 Left 913503669 1:119496029-119496051 CCCTTGAGGGAGCCTTCCAATTC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 913503675 1:119496063-119496085 CTTCTTGATGTCATCATATTTGG 0: 10
1: 16
2: 16
3: 43
4: 339
913503669_913503676 15 Left 913503669 1:119496029-119496051 CCCTTGAGGGAGCCTTCCAATTC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 913503676 1:119496067-119496089 TTGATGTCATCATATTTGGCAGG 0: 11
1: 12
2: 12
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913503669 Original CRISPR GAATTGGAAGGCTCCCTCAA GGG (reversed) Intergenic
903112078 1:21144348-21144370 GAGGTGGGAGGCTCCCTCAAGGG - Intronic
904553291 1:31339596-31339618 GCATTGGAGTGCTCCATCAATGG + Intronic
912341986 1:108925503-108925525 GAGTTGGAAGGATACCCCAAGGG + Intronic
913281536 1:117189850-117189872 GGATTCCAAGGCTCCCACAAAGG - Intronic
913407285 1:118509318-118509340 GAATTGGAATACTGCCTCAAGGG + Intergenic
913503669 1:119496029-119496051 GAATTGGAAGGCTCCCTCAAGGG - Intergenic
1064634256 10:17347649-17347671 GACTTGCAAGGATCCCTCCAGGG + Intronic
1068107011 10:52631156-52631178 GAATTGGAAGGCTTTGACAAAGG - Intergenic
1069861585 10:71475076-71475098 GAACTGGAAGGCACCCTGCAGGG - Intronic
1070493713 10:77001450-77001472 AAGTGGGAAGGCTCTCTCAAGGG + Exonic
1073104821 10:101026539-101026561 TAACTGGAAGGCCTCCTCAAGGG - Intronic
1076546953 10:131251618-131251640 GAAATGGAAGGCACCATGAAGGG + Intronic
1077573366 11:3357443-3357465 GGATTGGAAGGCTCCCATAGTGG + Intronic
1077773580 11:5247556-5247578 TAATTGGAAGGCTTACTTAATGG - Intergenic
1083415119 11:62520546-62520568 AAAGTGGAAGGCGACCTCAAGGG - Exonic
1083415345 11:62521938-62521960 AAAGTGGAAGGCGACCTCAAGGG - Exonic
1087363547 11:97191199-97191221 GAATGGGATGGCTGCCTCTAGGG - Intergenic
1087828846 11:102797093-102797115 GAGTTGGAAGGCTTTCTCAATGG + Exonic
1088750537 11:112838747-112838769 GTAATGGAAGCCTCCGTCAAGGG - Intergenic
1097155727 12:57010840-57010862 GGTTGGGAATGCTCCCTCAATGG + Exonic
1097975013 12:65676174-65676196 GAAATGGGTGGCTGCCTCAAAGG - Intergenic
1102251564 12:111390888-111390910 GAAATGAGAGGCTCCCTTAAAGG - Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1116976297 14:51119898-51119920 GAATTGGAAGGTTCTCTAACAGG + Intergenic
1117505208 14:56395395-56395417 CAATTGGAAGGCACTCCCAATGG + Intergenic
1117847257 14:59924342-59924364 GAATTTGGAAGCTCCATCAAAGG - Intronic
1119359727 14:74038470-74038492 GAATTTTAAGTCTTCCTCAAAGG - Intronic
1119570922 14:75671370-75671392 GAATTGCAAGGGACCCTGAATGG - Intronic
1120337207 14:83172236-83172258 AAATTGGAAGGCTGACTGAAAGG - Intergenic
1121876287 14:97456511-97456533 CAAATGGAAAGCTGCCTCAAGGG + Intergenic
1134145339 16:11756177-11756199 GAAAAGAAAGGCTCCATCAATGG + Intronic
1143829756 17:9641763-9641785 GAATTGGAAGGTTCCCTGTCTGG + Exonic
1146524197 17:33552144-33552166 GAATTTGAAGGGGCCCTGAAAGG + Intronic
1151329382 17:73398017-73398039 GGATGGTAAGGCTCCCTCGAGGG - Exonic
1156272735 18:35551878-35551900 GAATTGTGAGGCTGCCTCCAGGG - Intergenic
1156488271 18:37480587-37480609 AAATTAGATGGATCCCTCAATGG + Intronic
1158391585 18:57049474-57049496 GAATTTCAAGGGTTCCTCAAAGG + Intergenic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
927364429 2:22277318-22277340 CAAATGGAAGGCTTTCTCAATGG + Intergenic
929392890 2:41492090-41492112 GAATTAGAAGGCTACCTATAGGG - Intergenic
929554319 2:42915927-42915949 GATTTGGAAGGGTCACTTAAGGG - Intergenic
935067359 2:99661206-99661228 GAAGTGGAATTCTCCCTCCAGGG - Intronic
939722725 2:145675105-145675127 GAATTGGGAGGCTCCCGAAGAGG + Intergenic
943516743 2:188898047-188898069 GAGTTGGAAGGCTTCTTTAAGGG + Intergenic
1168803384 20:658520-658542 GATCTGGAAGGCTGCCTCAGTGG + Intronic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1181515611 22:23410064-23410086 GAGTTGGACGACTCCCTAAAAGG + Intergenic
949833342 3:8240859-8240881 GACTTGGAAGGATCTCTCAGTGG - Intergenic
955340047 3:58118166-58118188 GGATTGGCAGGCACCCTCACGGG - Intronic
960037946 3:113120581-113120603 GAAATGGAAGGCTACCACAGTGG + Intergenic
964929629 3:162001390-162001412 GAATTGAAAAACTCCCTGAAGGG - Intergenic
970359846 4:15298072-15298094 GAGTTGGAATGCTCCCTGGAGGG - Intergenic
976480841 4:85543109-85543131 GATTTGGAAGACTCCCTCATAGG + Intronic
976514574 4:85950259-85950281 GAAGTGGGAGGATCCCTTAAGGG + Intronic
991174676 5:63673313-63673335 GAATTGGAAGGCTACCTGTAGGG + Intergenic
994057769 5:95438398-95438420 GAAATGGAAGGCTGACTTAAAGG + Intronic
997028121 5:130090321-130090343 GAATTGGAAGACTCCAGTAAAGG - Intronic
1002278865 5:178119527-178119549 GAATTGGGAGGCTCCATTAGGGG - Intronic
1002903059 6:1425958-1425980 GAATTGTAAGGAACCCGCAAGGG + Intergenic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1014291505 6:119563852-119563874 GAATAGGAATGCTTCTTCAATGG - Intergenic
1020453886 7:8350020-8350042 GAAGTGGAAGGGTCGATCAAAGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1022508175 7:30919766-30919788 GAATTGGAAGGGGCACTCAAAGG - Intronic
1025868604 7:65409139-65409161 GAATTTGAAGGTACCCTGAATGG + Intergenic
1028218416 7:88164128-88164150 GACTTGGAAGACTCCTTCATAGG - Intronic
1028683510 7:93566442-93566464 GAATTAGGAGCCTCTCTCAATGG - Intronic
1028911473 7:96212569-96212591 CCATTGAAAAGCTCCCTCAAAGG - Intronic
1033349008 7:140546699-140546721 GAATTGGACTGCTCACTGAAAGG + Intronic
1033604006 7:142912070-142912092 GAATTAGAAGTGACCCTCAATGG - Intronic
1045487495 8:102643492-102643514 GAATTGGCAGCCACCCTCAGTGG + Intergenic
1046148220 8:110189601-110189623 GGATTGGAAGGCTCCTTCTCAGG + Intergenic
1046499440 8:115056769-115056791 CAAGTGGGTGGCTCCCTCAAAGG + Intergenic
1051049970 9:12920637-12920659 GATTTGGAATGTTCCATCAATGG - Intergenic
1051859141 9:21604476-21604498 GAAAGGTAAGGCTCCATCAAAGG + Intergenic
1060018841 9:120110981-120111003 GAATTGTAAGACTCCCTCTATGG + Intergenic
1188187855 X:27137772-27137794 GAATTGGAGGGCTCTGTCATTGG + Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1190536860 X:51437546-51437568 AACTTGGAAGTCTCCCTAAATGG - Intergenic