ID: 913507766

View in Genome Browser
Species Human (GRCh38)
Location 1:119533935-119533957
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913507766_913507771 23 Left 913507766 1:119533935-119533957 CCAAGATGCCCTCGAAGGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 74
Right 913507771 1:119533981-119534003 TTGATGTCATCATTTTTGGCAGG 0: 1
1: 11
2: 12
3: 37
4: 250
913507766_913507770 19 Left 913507766 1:119533935-119533957 CCAAGATGCCCTCGAAGGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 74
Right 913507770 1:119533977-119533999 TTTCTTGATGTCATCATTTTTGG 0: 1
1: 1
2: 15
3: 76
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913507766 Original CRISPR GTTCCCCTTCGAGGGCATCT TGG (reversed) Intergenic