ID: 913507767 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:119533943-119533965 |
Sequence | GCATCGGAGTTCCCCTTCGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 22 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 21} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
913507767_913507770 | 11 | Left | 913507767 | 1:119533943-119533965 | CCCTCGAAGGGGAACTCCGATGC | 0: 1 1: 0 2: 0 3: 0 4: 21 |
||
Right | 913507770 | 1:119533977-119533999 | TTTCTTGATGTCATCATTTTTGG | 0: 1 1: 1 2: 15 3: 76 4: 556 |
||||
913507767_913507772 | 26 | Left | 913507767 | 1:119533943-119533965 | CCCTCGAAGGGGAACTCCGATGC | 0: 1 1: 0 2: 0 3: 0 4: 21 |
||
Right | 913507772 | 1:119533992-119534014 | ATTTTTGGCAGGATTTACATAGG | 0: 1 1: 0 2: 1 3: 21 4: 222 |
||||
913507767_913507771 | 15 | Left | 913507767 | 1:119533943-119533965 | CCCTCGAAGGGGAACTCCGATGC | 0: 1 1: 0 2: 0 3: 0 4: 21 |
||
Right | 913507771 | 1:119533981-119534003 | TTGATGTCATCATTTTTGGCAGG | 0: 1 1: 11 2: 12 3: 37 4: 250 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
913507767 | Original CRISPR | GCATCGGAGTTCCCCTTCGA GGG (reversed) | Intergenic | ||