ID: 913507767

View in Genome Browser
Species Human (GRCh38)
Location 1:119533943-119533965
Sequence GCATCGGAGTTCCCCTTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 21}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913507767_913507770 11 Left 913507767 1:119533943-119533965 CCCTCGAAGGGGAACTCCGATGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 913507770 1:119533977-119533999 TTTCTTGATGTCATCATTTTTGG 0: 1
1: 1
2: 15
3: 76
4: 556
913507767_913507771 15 Left 913507767 1:119533943-119533965 CCCTCGAAGGGGAACTCCGATGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 913507771 1:119533981-119534003 TTGATGTCATCATTTTTGGCAGG 0: 1
1: 11
2: 12
3: 37
4: 250
913507767_913507772 26 Left 913507767 1:119533943-119533965 CCCTCGAAGGGGAACTCCGATGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 913507772 1:119533992-119534014 ATTTTTGGCAGGATTTACATAGG 0: 1
1: 0
2: 1
3: 21
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913507767 Original CRISPR GCATCGGAGTTCCCCTTCGA GGG (reversed) Intergenic
913507767 1:119533943-119533965 GCATCGGAGTTCCCCTTCGAGGG - Intergenic
1074791630 10:116894622-116894644 GAACAGGAGTTCCCTTTCGAAGG + Intronic
1089074660 11:115728619-115728641 GCATCGCAGCTCCCCCTCCATGG + Intergenic
1091190989 11:133695130-133695152 GCATCAGAGCTTCCCTTGGAGGG + Intergenic
1094855235 12:34399949-34399971 GCATCAGAGGTCCCCTGCAACGG + Intergenic
1105292500 13:19061785-19061807 GCCTCTGGGTTCCCCTTCGTTGG - Intergenic
1130990310 15:88872045-88872067 CCAGCGGAAGTCCCCTTCGATGG - Exonic
1134614755 16:15642781-15642803 GCGCCGCTGTTCCCCTTCGAGGG - Intronic
1141278035 16:82605841-82605863 GCATCAGAGGTCCTCTTCTATGG + Intergenic
1157438576 18:47692206-47692228 GCATGGGAGTTTGCCTTTGAGGG - Intergenic
925978962 2:9161663-9161685 CCATCGGAGTCCTCCTACGAGGG + Intergenic
937482623 2:122278030-122278052 GCATTGGAGTTTCCCCTCCACGG - Intergenic
1172006370 20:31821476-31821498 GCATCAGAGCTCACCTTTGAAGG + Exonic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1182751663 22:32646418-32646440 GCATCTGAGTCCCCCTGGGAAGG + Intronic
1184777122 22:46628774-46628796 GCATCAGGGATCCCCTTCGGGGG + Intronic
966903717 3:184506798-184506820 GCATTGGACTTCCCCTCAGAAGG - Intronic
968729207 4:2261785-2261807 GCCTCGGTGCTGCCCTTCGACGG - Exonic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1200011294 X:153122909-153122931 GCATTCAAGTTCCTCTTCGAAGG - Intergenic
1200028305 X:153277013-153277035 GCATTCAAGTTCCTCTTCGAAGG + Intergenic