ID: 913507768

View in Genome Browser
Species Human (GRCh38)
Location 1:119533944-119533966
Sequence AGCATCGGAGTTCCCCTTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913507768_913507771 14 Left 913507768 1:119533944-119533966 CCTCGAAGGGGAACTCCGATGCT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 913507771 1:119533981-119534003 TTGATGTCATCATTTTTGGCAGG 0: 1
1: 11
2: 12
3: 37
4: 250
913507768_913507770 10 Left 913507768 1:119533944-119533966 CCTCGAAGGGGAACTCCGATGCT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 913507770 1:119533977-119533999 TTTCTTGATGTCATCATTTTTGG 0: 1
1: 1
2: 15
3: 76
4: 556
913507768_913507772 25 Left 913507768 1:119533944-119533966 CCTCGAAGGGGAACTCCGATGCT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 913507772 1:119533992-119534014 ATTTTTGGCAGGATTTACATAGG 0: 1
1: 0
2: 1
3: 21
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913507768 Original CRISPR AGCATCGGAGTTCCCCTTCG AGG (reversed) Intergenic