ID: 913507768 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:119533944-119533966 |
| Sequence | AGCATCGGAGTTCCCCTTCG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 28 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 25} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 913507768_913507771 | 14 | Left | 913507768 | 1:119533944-119533966 | CCTCGAAGGGGAACTCCGATGCT | 0: 1 1: 0 2: 0 3: 2 4: 25 |
||
| Right | 913507771 | 1:119533981-119534003 | TTGATGTCATCATTTTTGGCAGG | 0: 1 1: 11 2: 12 3: 37 4: 250 |
||||
| 913507768_913507772 | 25 | Left | 913507768 | 1:119533944-119533966 | CCTCGAAGGGGAACTCCGATGCT | 0: 1 1: 0 2: 0 3: 2 4: 25 |
||
| Right | 913507772 | 1:119533992-119534014 | ATTTTTGGCAGGATTTACATAGG | 0: 1 1: 0 2: 1 3: 21 4: 222 |
||||
| 913507768_913507770 | 10 | Left | 913507768 | 1:119533944-119533966 | CCTCGAAGGGGAACTCCGATGCT | 0: 1 1: 0 2: 0 3: 2 4: 25 |
||
| Right | 913507770 | 1:119533977-119533999 | TTTCTTGATGTCATCATTTTTGG | 0: 1 1: 1 2: 15 3: 76 4: 556 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 913507768 | Original CRISPR | AGCATCGGAGTTCCCCTTCG AGG (reversed) | Intergenic | ||