ID: 913507769

View in Genome Browser
Species Human (GRCh38)
Location 1:119533959-119533981
Sequence AGAAAGTGTTGAAGCAGCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 562}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913507769_913507772 10 Left 913507769 1:119533959-119533981 CCGATGCTGCTTCAACACTTTCT 0: 1
1: 0
2: 1
3: 46
4: 562
Right 913507772 1:119533992-119534014 ATTTTTGGCAGGATTTACATAGG 0: 1
1: 0
2: 1
3: 21
4: 222
913507769_913507773 19 Left 913507769 1:119533959-119533981 CCGATGCTGCTTCAACACTTTCT 0: 1
1: 0
2: 1
3: 46
4: 562
Right 913507773 1:119534001-119534023 AGGATTTACATAGGCAAGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 97
913507769_913507770 -5 Left 913507769 1:119533959-119533981 CCGATGCTGCTTCAACACTTTCT 0: 1
1: 0
2: 1
3: 46
4: 562
Right 913507770 1:119533977-119533999 TTTCTTGATGTCATCATTTTTGG 0: 1
1: 1
2: 15
3: 76
4: 556
913507769_913507771 -1 Left 913507769 1:119533959-119533981 CCGATGCTGCTTCAACACTTTCT 0: 1
1: 0
2: 1
3: 46
4: 562
Right 913507771 1:119533981-119534003 TTGATGTCATCATTTTTGGCAGG 0: 1
1: 11
2: 12
3: 37
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913507769 Original CRISPR AGAAAGTGTTGAAGCAGCAT CGG (reversed) Intergenic