ID: 913507771

View in Genome Browser
Species Human (GRCh38)
Location 1:119533981-119534003
Sequence TTGATGTCATCATTTTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 11, 2: 12, 3: 37, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913507765_913507771 24 Left 913507765 1:119533934-119533956 CCCAAGATGCCCTCGAAGGGGAA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 913507771 1:119533981-119534003 TTGATGTCATCATTTTTGGCAGG 0: 1
1: 11
2: 12
3: 37
4: 250
913507767_913507771 15 Left 913507767 1:119533943-119533965 CCCTCGAAGGGGAACTCCGATGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 913507771 1:119533981-119534003 TTGATGTCATCATTTTTGGCAGG 0: 1
1: 11
2: 12
3: 37
4: 250
913507766_913507771 23 Left 913507766 1:119533935-119533957 CCAAGATGCCCTCGAAGGGGAAC 0: 1
1: 0
2: 1
3: 4
4: 74
Right 913507771 1:119533981-119534003 TTGATGTCATCATTTTTGGCAGG 0: 1
1: 11
2: 12
3: 37
4: 250
913507768_913507771 14 Left 913507768 1:119533944-119533966 CCTCGAAGGGGAACTCCGATGCT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 913507771 1:119533981-119534003 TTGATGTCATCATTTTTGGCAGG 0: 1
1: 11
2: 12
3: 37
4: 250
913507769_913507771 -1 Left 913507769 1:119533959-119533981 CCGATGCTGCTTCAACACTTTCT 0: 1
1: 0
2: 1
3: 46
4: 562
Right 913507771 1:119533981-119534003 TTGATGTCATCATTTTTGGCAGG 0: 1
1: 11
2: 12
3: 37
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913507771 Original CRISPR TTGATGTCATCATTTTTGGC AGG Intergenic