ID: 913507772

View in Genome Browser
Species Human (GRCh38)
Location 1:119533992-119534014
Sequence ATTTTTGGCAGGATTTACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913507768_913507772 25 Left 913507768 1:119533944-119533966 CCTCGAAGGGGAACTCCGATGCT 0: 1
1: 0
2: 0
3: 2
4: 25
Right 913507772 1:119533992-119534014 ATTTTTGGCAGGATTTACATAGG 0: 1
1: 0
2: 1
3: 21
4: 222
913507769_913507772 10 Left 913507769 1:119533959-119533981 CCGATGCTGCTTCAACACTTTCT 0: 1
1: 0
2: 1
3: 46
4: 562
Right 913507772 1:119533992-119534014 ATTTTTGGCAGGATTTACATAGG 0: 1
1: 0
2: 1
3: 21
4: 222
913507767_913507772 26 Left 913507767 1:119533943-119533965 CCCTCGAAGGGGAACTCCGATGC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 913507772 1:119533992-119534014 ATTTTTGGCAGGATTTACATAGG 0: 1
1: 0
2: 1
3: 21
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913507772 Original CRISPR ATTTTTGGCAGGATTTACAT AGG Intergenic