ID: 913507879

View in Genome Browser
Species Human (GRCh38)
Location 1:119534743-119534765
Sequence TTCCCAAGGCACCACAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913507879_913507884 21 Left 913507879 1:119534743-119534765 CCTTCACTGTGGTGCCTTGGGAA 0: 1
1: 0
2: 2
3: 22
4: 219
Right 913507884 1:119534787-119534809 AAATGTGGCTGTCTGTCGAACGG No data
913507879_913507885 22 Left 913507879 1:119534743-119534765 CCTTCACTGTGGTGCCTTGGGAA 0: 1
1: 0
2: 2
3: 22
4: 219
Right 913507885 1:119534788-119534810 AATGTGGCTGTCTGTCGAACGGG No data
913507879_913507883 6 Left 913507879 1:119534743-119534765 CCTTCACTGTGGTGCCTTGGGAA 0: 1
1: 0
2: 2
3: 22
4: 219
Right 913507883 1:119534772-119534794 TGGCGCTGCACAAGAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913507879 Original CRISPR TTCCCAAGGCACCACAGTGA AGG (reversed) Intergenic
902989629 1:20177491-20177513 TTTCCAAGGCACTACAATTAGGG - Intergenic
904634546 1:31869734-31869756 GAACCAAGGCACCACAGTGGTGG - Intergenic
905484829 1:38288168-38288190 TTCCCACGGTTACACAGTGATGG + Intergenic
907078065 1:51595863-51595885 TTCCCAAGGTCACACAGAGATGG + Intronic
907646528 1:56250065-56250087 GTGCCAAGGCACCACAATGGTGG - Intergenic
909088602 1:71197663-71197685 TTCCCACAGCAGCAGAGTGATGG + Intergenic
913507879 1:119534743-119534765 TTCCCAAGGCACCACAGTGAAGG - Intergenic
915228826 1:154430649-154430671 TTCCCGAGGCCCCCCAGAGAGGG + Intronic
916388839 1:164307733-164307755 ATGCCAAGTCTCCACAGTGATGG + Intergenic
917635340 1:176930306-176930328 TTCTCCAGGCACCTCAATGATGG - Intronic
920170082 1:204066451-204066473 TTCCCAAGACCACACAGTGAAGG - Intergenic
921793752 1:219319317-219319339 TTCCCCAGGCACCACATTAATGG - Intergenic
923241211 1:232087412-232087434 TTTCCAAGGCACCACATTTTGGG + Intergenic
923555057 1:234993893-234993915 TTGACAAGGCCCCCCAGTGATGG + Intergenic
1063905425 10:10775946-10775968 GTGACAAGGCAGCACAGTGAGGG - Intergenic
1069389235 10:67915019-67915041 TTCCCAAGACACCACAGGCAGGG - Intronic
1069826803 10:71259739-71259761 TTGCCCAGGCCCCACAGGGAGGG + Intronic
1077000819 11:321347-321369 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000876 11:321620-321642 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000894 11:321698-321720 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000921 11:321815-321837 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000938 11:321893-321915 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000973 11:322049-322071 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001000 11:322166-322188 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001017 11:322244-322266 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001044 11:322361-322383 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001061 11:322439-322461 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001079 11:322517-322539 CTGCCTGGGCACCACAGTGAGGG - Intronic
1078664945 11:13316506-13316528 TCACCAAGGTACCAAAGTGAGGG - Intronic
1079355552 11:19727470-19727492 TTCCCAGGGCACCAGTGGGAGGG + Intronic
1080836895 11:35947704-35947726 TACCCAGGGTACCACAGTAAAGG + Intronic
1081716072 11:45251578-45251600 TCCTCAAGGAACCACAGTGCAGG + Intronic
1083313019 11:61795346-61795368 TTCCCATGGCAACACAGAGGAGG - Exonic
1085940825 11:81204563-81204585 CTCCCAAGGGCTCACAGTGAAGG - Intergenic
1086668012 11:89508838-89508860 TTCACAAAGCAACAAAGTGACGG + Intergenic
1087032202 11:93716837-93716859 CTGCCTAGGCACCATAGTGAAGG - Intronic
1088489353 11:110371718-110371740 TCCCCAAGCCATCACAATGACGG - Intergenic
1088576242 11:111274315-111274337 TTCCCAGGTCACCACAGAGGGGG + Intronic
1088816784 11:113426702-113426724 TCCCCGAGGCTCCAGAGTGATGG - Intronic
1088889653 11:114034692-114034714 TTCCCATGGGACCTCCGTGAGGG + Intergenic
1089467209 11:118693003-118693025 TTCCCAAGAGACCCCACTGAAGG + Intergenic
1089684640 11:120138986-120139008 TGACCAAGGCACAACAATGAGGG + Intronic
1090342161 11:126033625-126033647 TTTCCAAGGTACTACAGTGTAGG + Intronic
1097287688 12:57890150-57890172 TTCCCAAGGGACCAGAGCCAGGG + Intergenic
1099574276 12:84361680-84361702 TGCCCAGGGGACCACCGTGACGG + Intergenic
1102559173 12:113749875-113749897 TGCCCAAGGCCACACAGTCAGGG + Intergenic
1102826233 12:115949987-115950009 CTCCCAAGGCAACACAGTGCGGG - Intergenic
1105963764 13:25366925-25366947 TTCCCAAAGAACAACATTGAAGG - Intergenic
1106435191 13:29717277-29717299 TTCCCAAAGCACCAAAGGGCTGG + Intergenic
1109951110 13:69502883-69502905 TCCCCAAGGTAGGACAGTGAAGG + Intergenic
1110148807 13:72225444-72225466 TTCTCAAGGAACCCAAGTGATGG + Intergenic
1112574217 13:100621252-100621274 ATCCCAAGGAACTGCAGTGACGG + Intronic
1114065711 14:19058421-19058443 TTTCCAAGGAACCTTAGTGATGG - Intergenic
1114096550 14:19341579-19341601 TTTCCAAGGAACCTTAGTGATGG + Intergenic
1114181642 14:20373095-20373117 TGCCCAAGCCACAGCAGTGACGG + Exonic
1114774789 14:25469315-25469337 ATCCCAAGGCAGAAAAGTGATGG + Intergenic
1117713511 14:58557276-58557298 TCCCCCAGGTACCACAGTCATGG + Intergenic
1121529383 14:94641634-94641656 CTCCTCAGGCACCACGGTGAGGG - Intergenic
1122181230 14:99956214-99956236 TGCCCAAATCCCCACAGTGAAGG + Intergenic
1122504818 14:102225849-102225871 TTTCCAGGGCACCTGAGTGAGGG - Intronic
1202848812 14_GL000225v1_random:2629-2651 TTCTCTAGGCTCCACAGGGAAGG - Intergenic
1202867872 14_GL000225v1_random:135013-135035 TTCTCTAGGCTCCACAGGGAGGG + Intergenic
1123506611 15:20947316-20947338 TTTTCAAGGCAGCATAGTGATGG + Intergenic
1125270743 15:37936047-37936069 TTCTCAAGAAACCAGAGTGAAGG + Intronic
1125821805 15:42638170-42638192 TTCCAGAGTCACCACAGGGATGG + Intronic
1127354831 15:58188333-58188355 TTCCTAAGACCCCACAGTGAGGG - Intronic
1129660431 15:77550096-77550118 TGCCCAAGGTTGCACAGTGAGGG + Intergenic
1129662032 15:77558244-77558266 TTCCCAAAGCAGCTCAGAGAGGG + Intergenic
1130113378 15:80985213-80985235 TGCCCAAGGCCACATAGTGATGG - Intronic
1130154388 15:81337209-81337231 CTCCCAAAGCACCACATTTAAGG - Intronic
1132201224 15:99956091-99956113 TTCCCATGGAACCACAGTAGAGG - Intergenic
1134247213 16:12548767-12548789 TCCCCCAGCCACCACAGTGCTGG + Intronic
1134677171 16:16098865-16098887 ATTCCCAGGCAGCACAGTGATGG + Intronic
1134745572 16:16585490-16585512 TTCCCAAGGCATCCAAGGGACGG + Intergenic
1134818546 16:17226859-17226881 TGCTCAAGGCCACACAGTGATGG - Intronic
1134999904 16:18768254-18768276 TTCCCAAGGCATCCAAGGGACGG - Intergenic
1137589138 16:49682717-49682739 TGCCCAAGGCCACACAGTCAGGG - Intronic
1138925480 16:61585179-61585201 TTCCAAAGAAACCACAGTGAAGG - Intergenic
1139322702 16:66128175-66128197 TTCCCCAGGCACCGCATTAAGGG - Intergenic
1140212660 16:72983126-72983148 TTCCAAGGGCTCCACCGTGATGG - Intronic
1140239964 16:73191780-73191802 TTCCCAGGGCAGCCCAGTGCAGG - Intergenic
1140307932 16:73821047-73821069 TTGCCAAGGCAACACAGTCAGGG + Intergenic
1141019891 16:80485303-80485325 CTCCCAAGGCAGCACAGAGCTGG + Intergenic
1141857574 16:86694367-86694389 TTCCTGAGGAACCACAGTGCTGG - Intergenic
1142676861 17:1518973-1518995 TTCCAAAGGGACCTCAATGAAGG + Exonic
1142856546 17:2733693-2733715 TTCCTAAGGCTCCACAGACAGGG - Intergenic
1142989000 17:3716657-3716679 TACTCATGGCATCACAGTGAGGG - Intronic
1143018201 17:3903101-3903123 TTCCCAAGTCTCCTCGGTGAGGG - Intronic
1144230869 17:13202105-13202127 TTCCCAAGGCTCCAGAATAAAGG + Intergenic
1144819076 17:18058757-18058779 TTCCCAAGGCATGACAGCTAGGG - Intronic
1145094171 17:20009861-20009883 CCCCCAAGGCACAACAGGGAGGG - Intronic
1145299558 17:21622528-21622550 TTCCCACAGCAGCACAGTGCTGG - Intergenic
1145350724 17:22080746-22080768 TTCCCACAGCAGCACAGTGCTGG + Intergenic
1151426736 17:74035574-74035596 ATCCCAAGGAACCACAGTGAAGG - Intergenic
1151923502 17:77175540-77175562 CTGCCCGGGCACCACAGTGAAGG - Intronic
1151950529 17:77351175-77351197 TTCCCAAGGCTGCACATGGAGGG + Intronic
1152408123 17:80108838-80108860 TTCCCAAAGACCCACAGTGTGGG - Intergenic
1154367100 18:13721187-13721209 TTCCCGAGGTAGGACAGTGAAGG + Intronic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1156220530 18:35046676-35046698 ATCCCAATGCACCACTGTGTGGG + Intronic
1158657300 18:59350001-59350023 GGCCCAAGGCACCAGAGTAAGGG + Intronic
1159273729 18:66188387-66188409 TTTCCAAGGCACTTAAGTGAAGG + Intergenic
1161167693 19:2797103-2797125 TTCACAAGGGACCCCAGCGAAGG - Intronic
1162761013 19:12888069-12888091 CTCCCAGGGCACCAGAGTGGAGG - Intergenic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1165434135 19:35787473-35787495 TTACCAAGGCAACAAAGTGATGG + Exonic
1166143625 19:40819664-40819686 TACCCAAGGCAACACAGCTAGGG + Intronic
1166183927 19:41127115-41127137 TACCCAAGGCAACACAGCTAGGG - Intronic
1167496271 19:49820450-49820472 CTGCCTGGGCACCACAGTGAAGG - Intronic
1168206156 19:54852031-54852053 TCCTCGAGGCACCACAGTGCTGG - Exonic
926764409 2:16311675-16311697 ATCCCACTGCACCACGGTGAGGG + Intergenic
927640376 2:24841879-24841901 GTCCCCAGGCACCACAGGGAGGG - Intronic
928635471 2:33241389-33241411 TTCCCATGGCATCAGAGTCAAGG + Intronic
929764688 2:44834255-44834277 CTCCAAAGGCACCACAGAGTTGG + Intergenic
929900830 2:46002001-46002023 TTCCCCAGGCAGCTCAGTGCTGG - Intronic
931245375 2:60488295-60488317 TTCCCACTGCACCAAAGAGACGG - Intronic
935643295 2:105310541-105310563 TTCTAAAGGCACCACAGAGAAGG + Intronic
938483127 2:131678790-131678812 TTTCCAAGGAACCTTAGTGATGG - Intergenic
938762301 2:134436861-134436883 CACCCAAAGCACCACAGTGGTGG + Intronic
939227557 2:139383211-139383233 TTACCAGGGCACCAAAGAGAGGG + Intergenic
939368441 2:141265403-141265425 AGCCCAAGGCACCCCAGTGGAGG + Intronic
940419402 2:153461706-153461728 CTGCCAAGGCTCCACAGGGAAGG + Intergenic
940975977 2:159944975-159944997 TCCTCAAGGCAACACAATGATGG + Exonic
942554946 2:177162350-177162372 TTCCCAAGCCTCCTCCGTGATGG + Intergenic
943523151 2:188979865-188979887 TTCCCAAGGTTACACAGTCAGGG - Intronic
943667575 2:190626211-190626233 CTCCCAATGCAGCACATTGAGGG + Intergenic
944503878 2:200390060-200390082 AGCCCAAGCCACCACAGTGCTGG + Intronic
946898153 2:224345650-224345672 GTCCCAAGGCTGCACAGTCAGGG + Intergenic
948375929 2:237520151-237520173 CTCCCAAGGCATGACAGGGAAGG + Intronic
1169061454 20:2663580-2663602 TTCCCAAAACATCACAGTCAAGG + Intronic
1171560973 20:26125730-26125752 TTCCCATAGCAGCACAGTGCTGG + Intergenic
1172428549 20:34872608-34872630 TTCCCAAGGCAGGGCAGGGACGG + Intronic
1174113331 20:48210990-48211012 CACCCGAGGCATCACAGTGAGGG - Intergenic
1175205803 20:57310246-57310268 TTACTCAGTCACCACAGTGAGGG + Intergenic
1175613681 20:60373946-60373968 TTCCCATGAAAACACAGTGAAGG - Intergenic
1178300711 21:31450518-31450540 TACCCAAAGGACCTCAGTGAAGG + Intronic
1179016953 21:37602218-37602240 TTCCCAAGCAAGCACAATGATGG + Intergenic
1180484192 22:15781013-15781035 TTTCCAAGGAACCTTAGTGATGG - Intergenic
1181734487 22:24870953-24870975 TTCCAAAGGCACATCAGTAAGGG - Intronic
1182681654 22:32084308-32084330 TGCCCAAGGCCACTCAGTGAGGG + Intronic
1183165958 22:36147604-36147626 TTGCCAAGGCAACTCAGTGAGGG + Intronic
1184597756 22:45524511-45524533 TGCCCAAGGCCCCAGAGGGAGGG - Intronic
949505299 3:4722050-4722072 TACCCAAGGTACCATAATGAGGG + Intronic
950708702 3:14800155-14800177 TCCTCATGGCACCACAGTGGTGG - Intergenic
952778087 3:37065850-37065872 TTCCTGAGACACAACAGTGATGG + Exonic
953285778 3:41607145-41607167 GTCTCAAGCCACCATAGTGATGG + Intronic
953749656 3:45599676-45599698 TTCCAAAGGCCCATCAGTGAGGG - Intronic
955049705 3:55398144-55398166 GTCCTAAGGCACTCCAGTGATGG + Intergenic
956008834 3:64808730-64808752 TTACCAAGCCAACGCAGTGATGG + Intergenic
956525213 3:70151580-70151602 TTCCCAAGACACCATAAAGATGG - Intergenic
957404980 3:79765674-79765696 TTCCCAAACAACCACAGTAAAGG + Intronic
957982255 3:87525405-87525427 GTCCCAAGGCTGCACAGAGATGG - Intergenic
958719536 3:97827002-97827024 TTGCCAAGGCAGCATAGTGGGGG + Intronic
959962013 3:112308220-112308242 GTGCCTGGGCACCACAGTGAAGG + Intergenic
961584494 3:127910934-127910956 TTACCAAGACACCAGAGTCAGGG + Intergenic
963068015 3:141279224-141279246 TTGCAGAGCCACCACAGTGAAGG - Intronic
965064544 3:163829605-163829627 TTCCCAAGGGTCCAGAGAGAGGG - Intergenic
966526931 3:180929721-180929743 TTCCCAAGCCACCAGAATGATGG - Intronic
966723258 3:183085749-183085771 TTCACAAGGCACCACGTAGAAGG - Intronic
969035599 4:4250903-4250925 TGCCCAAAGACCCACAGTGATGG - Intergenic
969598442 4:8161864-8161886 TTTCCAAGGCACCAGCGTAAAGG + Intergenic
976596808 4:86902576-86902598 TTCCCAAGGTACCACGCTGGGGG - Intronic
977910851 4:102534325-102534347 TTCCAAAGGCAGCACAGAAAAGG - Intronic
978474592 4:109111503-109111525 TTCCGAATGCAAGACAGTGAGGG - Intronic
979904065 4:126262370-126262392 TTCCCATGGCACAGAAGTGAAGG + Intergenic
981787429 4:148497443-148497465 TCCCCAAAGCACCACTTTGAGGG + Intergenic
983064396 4:163192394-163192416 TTCCCAAGGCACGACCATAAAGG - Intergenic
986385260 5:7226997-7227019 TTCCCCAGGCATCCCAGAGATGG + Intergenic
988057501 5:26117981-26118003 TTGTCAAGGAAGCACAGTGAGGG - Intergenic
989287834 5:39722911-39722933 TTCCCAATGCGACACAGAGACGG - Intergenic
989774656 5:45189588-45189610 ATCCCAAGGTACCACACTAAGGG - Intergenic
992504244 5:77369744-77369766 GTTCAAAGGCACCACAGGGAAGG - Intronic
993487198 5:88501662-88501684 CTGCCAAGGCACCAAAGAGACGG + Intergenic
993733804 5:91451955-91451977 TACCCAAGGAACCACAATGAAGG - Intergenic
994582736 5:101666909-101666931 TTCCCAAGGCACTTCAGTTCAGG + Intergenic
995463673 5:112428872-112428894 TTCCCTAGGTACCACATTTAAGG - Intergenic
1001315905 5:170641198-170641220 TTCCCAAGGACCCAGAGTGATGG - Intronic
1001931227 5:175674450-175674472 TCCCCTAGGCATCATAGTGAGGG - Intronic
1011592670 6:88985617-88985639 TTACCAAAGAATCACAGTGAAGG + Intergenic
1013481742 6:110558715-110558737 TTTCCATGGCATCACACTGATGG - Intergenic
1016510672 6:144839367-144839389 TTCCTAAGGCACCAGTGTGTAGG - Intronic
1016597300 6:145815766-145815788 TTCCCAAAGCACAACAGCAAGGG - Intergenic
1017717671 6:157223704-157223726 CTCCCAAGGGAACACAGAGAAGG + Intergenic
1017807991 6:157962949-157962971 AACCCAAGCCACCACTGTGAAGG + Intergenic
1018867675 6:167758681-167758703 TTCCCAAGGCTTCACTGGGATGG + Intergenic
1019406052 7:884624-884646 TTCAGAAGGCACCACAGCCAGGG - Intronic
1019742268 7:2680788-2680810 TTCCCAGGGCACGACCCTGATGG + Intronic
1020432559 7:8128614-8128636 GGCCCAGGGCACGACAGTGAAGG + Intronic
1023337057 7:39181237-39181259 TTCTCAAAGGACCACAGTGGAGG - Intronic
1023786230 7:43710800-43710822 TTTCCAAAACACCACAGTGCTGG + Intronic
1024096061 7:45983710-45983732 TGGCCAGGGCCCCACAGTGAAGG - Intergenic
1024546723 7:50528648-50528670 TCCCCAAGGCTCCACAGTCAGGG - Intronic
1024696214 7:51859226-51859248 TACTCAAGGCACCAGAGAGATGG + Intergenic
1026681727 7:72472142-72472164 TTCCAAATCCACCACAGTGAAGG + Intergenic
1026768236 7:73173972-73173994 TTCCCATGGCACCATGGTGTGGG + Intergenic
1027044699 7:74983680-74983702 TTCCCATGGCACCATGGTGTGGG + Intronic
1027078938 7:75218679-75218701 TTCCCATGGCACCATGGTGTGGG - Intergenic
1028898089 7:96064568-96064590 ATCTCAAGGTACCAAAGTGAGGG + Intronic
1029887917 7:103892488-103892510 TCCCCATGACACCACAGTCATGG + Intronic
1031347945 7:120692330-120692352 GTCCCCAAGCACCACAGTCAAGG - Intronic
1031939370 7:127771282-127771304 TTCCCAAGGGACCAAATTTAAGG + Intronic
1034017906 7:147607322-147607344 ATCCCAAGGCACCACACTGTGGG + Intronic
1035084857 7:156249367-156249389 ATACCAAGGCACCACCGGGAAGG + Intergenic
1037086366 8:14855789-14855811 TTCCAAAGGCAGCCTAGTGATGG + Intronic
1038635803 8:29286328-29286350 TTCCTAAGACACCAAAGAGAAGG + Intergenic
1039811654 8:41054432-41054454 TTCAAGAGGGACCACAGTGATGG - Intergenic
1039816779 8:41101272-41101294 ATCCCAAGGCCTAACAGTGAAGG + Intergenic
1041011651 8:53549606-53549628 TTCCCAGGACAGCACAGTTAAGG + Intergenic
1041367531 8:57124482-57124504 TGCCCAAGATCCCACAGTGAAGG - Intergenic
1042445156 8:68875772-68875794 TTCCCAAAGCTCCTCTGTGAAGG + Intergenic
1042504653 8:69547280-69547302 TTCACAAGGCATCACAGTTCAGG - Intronic
1045079636 8:98611477-98611499 TTCCCTAGGCACGAAAATGAGGG - Intronic
1045851869 8:106709975-106709997 TTACCAAGGCAGCACACTGGAGG - Intronic
1047207825 8:122817719-122817741 GTCCAAAGGCAGCACAATGATGG - Intronic
1047384224 8:124394748-124394770 CTCCCATGGGACCTCAGTGAGGG - Intergenic
1052946904 9:34175935-34175957 CTCTCAAGGCAGCCCAGTGAGGG - Intergenic
1053283673 9:36837318-36837340 TTCCCAAGGCACCTTAGTTAAGG - Exonic
1055268994 9:74534530-74534552 TGCCCCTGGCACCAGAGTGATGG + Intronic
1055775236 9:79760594-79760616 TTCCCAAATCACCACATTGAAGG + Intergenic
1058741066 9:107942962-107942984 ATGCCAATTCACCACAGTGACGG + Intergenic
1060484188 9:124036859-124036881 CTCCCAGGGGGCCACAGTGATGG + Intergenic
1060877630 9:127094666-127094688 TTCCAAAGGAAGCTCAGTGAGGG + Intronic
1061069077 9:128297592-128297614 TTCCCAAGGAAGCACAGAGAAGG + Intergenic
1061382695 9:130267934-130267956 TTCCGAAGACATCACACTGAAGG + Intergenic
1061411874 9:130426167-130426189 TTCCCCAGGCCCCAGGGTGAAGG + Intronic
1061428748 9:130517917-130517939 TCCCGCAGGAACCACAGTGAAGG + Intergenic
1062108753 9:134770189-134770211 TTGCAAAGGCAGCACATTGAGGG + Intronic
1062135298 9:134923752-134923774 TTCCCGGCTCACCACAGTGAGGG + Intergenic
1203736899 Un_GL000216v2:145254-145276 TTCTCTAGGCTCCACAGGGAGGG - Intergenic
1203454990 Un_GL000219v1:158587-158609 TCCCCATGGGACCTCAGTGAAGG - Intergenic
1186935493 X:14446210-14446232 TTCCCAAGGGGCCACAGTGAAGG - Intergenic
1188261535 X:28030541-28030563 TTTCCAAGGCACCACTGTGCTGG + Intergenic
1189839484 X:45058537-45058559 TTCCCAAGTAACAACACTGAGGG - Intronic
1191654571 X:63582078-63582100 CTTCCAAGGCACCATAGTGTAGG + Intergenic
1192358396 X:70423759-70423781 TTCCCAAGGCAGCATAAAGAGGG + Intronic
1194482760 X:94447012-94447034 TTCCCTAGCCACCACTGTTATGG + Intergenic
1194595314 X:95849381-95849403 TTTCAAAGGCAACACAGAGAAGG + Intergenic
1195223775 X:102771368-102771390 TGCCCAAGGAACCCCAGAGAGGG - Intergenic
1196003005 X:110806665-110806687 TACCCAAGGGTCCACAGGGAGGG - Intergenic
1196458507 X:115906429-115906451 TCCCCAAGCAACCACAGGGAAGG + Intergenic
1196512806 X:116532296-116532318 ATCCCAAGGCTCCACAGAGAAGG + Intergenic
1200356988 X:155562348-155562370 TTCCCAAGGCTGCACAGAGCAGG + Intronic
1200415222 Y:2902980-2903002 CTGCCTGGGCACCACAGTGAAGG + Intronic
1201176106 Y:11308947-11308969 TTCTCTAGGCTCCACAGGGAGGG - Intergenic