ID: 913510688

View in Genome Browser
Species Human (GRCh38)
Location 1:119558944-119558966
Sequence GCATCAGAGGGTCCCCATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913510688_913510695 12 Left 913510688 1:119558944-119558966 CCCTTATGGGGACCCTCTGATGC 0: 1
1: 0
2: 2
3: 12
4: 107
Right 913510695 1:119558979-119559001 CTTCTTGATGTTATCATATTTGG No data
913510688_913510696 16 Left 913510688 1:119558944-119558966 CCCTTATGGGGACCCTCTGATGC 0: 1
1: 0
2: 2
3: 12
4: 107
Right 913510696 1:119558983-119559005 TTGATGTTATCATATTTGGCAGG No data
913510688_913510697 29 Left 913510688 1:119558944-119558966 CCCTTATGGGGACCCTCTGATGC 0: 1
1: 0
2: 2
3: 12
4: 107
Right 913510697 1:119558996-119559018 ATTTGGCAGGTTTTTCCAGATGG 0: 8
1: 13
2: 10
3: 61
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913510688 Original CRISPR GCATCAGAGGGTCCCCATAA GGG (reversed) Intergenic
900251499 1:1672676-1672698 GCATCTGGGGGTCCCCATGGTGG + Intronic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
910357557 1:86377510-86377532 CCAGCAGAGGTTCCCCATAAGGG + Intronic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
911011813 1:93288630-93288652 GCAGCAGAGGTTCTCCATGAGGG - Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913499865 1:119462222-119462244 ACATCAGAGGATCCCCTCAAGGG - Intergenic
913510688 1:119558944-119558966 GCATCAGAGGGTCCCCATAAGGG - Intergenic
913514906 1:119596360-119596382 GCATCAGAAGGCCCCCATAAGGG - Intergenic
916999159 1:170337270-170337292 GCTCCTGAGGGTCCCCAAAAAGG + Intergenic
917396605 1:174600933-174600955 CTATCAGAGGTTCCCCATGAGGG + Intronic
918886221 1:190197915-190197937 TTAACAGAGGGTCCCCATAATGG + Intronic
922726383 1:227924887-227924909 GCATCAGAGAGCCCTCATGAGGG + Intronic
922738519 1:228002918-228002940 GCGGCAGTGGGTCCTCATAAAGG + Intergenic
1063128496 10:3157022-3157044 GCTCCACAGGGTCCCCATCATGG + Exonic
1068864141 10:61877428-61877450 ACATCACAGGGTCATCATAAGGG - Intergenic
1075583116 10:123637114-123637136 GCAGCAGATTGGCCCCATAATGG + Intergenic
1077155260 11:1088222-1088244 GCATCACAGGGGCTCCAAAAAGG - Intergenic
1079002993 11:16773380-16773402 GCATCAGCAGGTCCCAATAATGG - Intergenic
1089861388 11:121593117-121593139 GCATCAGAGGGCTCCAATACTGG - Intronic
1094871745 12:34602713-34602735 GCAGCAGAGGTTCCCCCTACAGG + Intergenic
1108933986 13:55864581-55864603 GCAGCAGAGGTTCTCCATGAGGG - Intergenic
1116154468 14:41185889-41185911 ACAACAGAGGTTCCCCATGAAGG + Intergenic
1118468295 14:66051933-66051955 GCATCTCAGGTTCCCCATATAGG + Intergenic
1119198787 14:72737784-72737806 GCATCAGAGGGAGCCCATGATGG - Intronic
1120564542 14:86038560-86038582 GCTTCAGAGGGTCTCCACCAGGG + Intergenic
1121379591 14:93451540-93451562 ACATCAGAGGGTCTCCGGAATGG - Intronic
1121902101 14:97703075-97703097 GCATCATAGAGTGCCCATACTGG - Intergenic
1122980811 14:105191699-105191721 GCAAGAGAGGGTCCCCGTCATGG + Intergenic
1124421765 15:29529181-29529203 GTGGCAGAGGGTCCACATAAAGG + Intronic
1125326726 15:38542731-38542753 GAGCCAGAGGGTCCCAATAATGG + Intronic
1126801556 15:52302789-52302811 GCATCAGAGGCTTCCCACTATGG - Intergenic
1126962975 15:54018639-54018661 GGATCAGAGAGTCACCATCATGG - Intronic
1129463517 15:75711590-75711612 GCATCACATGGTTCCCAGAAGGG - Intronic
1129721368 15:77879812-77879834 GCATCACATGGTTCCCAGAAGGG + Intergenic
1130322161 15:82850410-82850432 GCATCAGAGGGTGCACAGACTGG - Intronic
1131890221 15:96964592-96964614 GCAGGAGCGGGTCTCCATAATGG - Intergenic
1132355954 15:101171428-101171450 GCAGCAGAGGATACCCATACAGG - Intergenic
1132702734 16:1229013-1229035 GCAGGTGAAGGTCCCCATAATGG - Exonic
1132705592 16:1241855-1241877 GCAGGTGAAGGTCCCCATAATGG + Exonic
1133481961 16:6179447-6179469 GCATCAGAGAGTCCCAACATGGG - Intronic
1135923645 16:26673312-26673334 GCGGCAGATGGTTCCCATAAGGG + Intergenic
1139374469 16:66488124-66488146 GCATGACAGGTTCCCCATGAGGG + Intronic
1146268174 17:31466825-31466847 GCATCCCTGGGTCCCCATTAGGG - Intronic
1149370952 17:55993006-55993028 GTAGCAGAGGTTCTCCATAACGG + Intergenic
1151835893 17:76582602-76582624 GGATCAGTGGGTCCCCACATGGG - Intronic
1152264432 17:79286158-79286180 ACGTCAGAGGGTCCTCACAAGGG - Intronic
1152704211 17:81834434-81834456 GCCTCAGTGGGTCCCCAGGATGG - Intronic
1153341305 18:3977836-3977858 GCATCAGAGGGGACCCTTGAGGG - Intronic
1153582038 18:6582916-6582938 GGATCAGAGGGGCTCCCTAAAGG + Intronic
1157172647 18:45422279-45422301 GTATGAGAAGGTCCCAATAAAGG + Intronic
1157584493 18:48792396-48792418 GCATCAGAGGGTTTCCAGCAGGG + Intronic
1157684370 18:49630752-49630774 ATAACAGAGGGTCCCCATCACGG - Intergenic
1160694215 19:474730-474752 GCAGCTGAGGGTCCCCATGGTGG + Exonic
1160879708 19:1313776-1313798 GCAGCAGAGGGTGGCCAGAAAGG - Intergenic
1165993817 19:39831132-39831154 ACTTCAGAGGGTACCCAAAATGG - Intronic
1167449277 19:49557333-49557355 CCATCAGAGGGTCCCCTTTGTGG - Intronic
1167490517 19:49790327-49790349 TCATCACAGGGTCCTTATAAGGG - Intronic
925560218 2:5183518-5183540 GCAGCAGAGGTTCTCCATGAGGG - Intergenic
928628461 2:33165608-33165630 GTATCAGAAGGTCCCCATACTGG - Intronic
929889221 2:45905649-45905671 GCATCAGAGGTTCCCCAGCTAGG - Intronic
932266491 2:70371584-70371606 GGATGAGAGTGGCCCCATAAAGG + Intergenic
932474239 2:71991517-71991539 GCAGCAGAGGGTCCCCATGAAGG - Intergenic
935789746 2:106580303-106580325 GCATCTGAGGTTCCCCACCAAGG + Intergenic
935822392 2:106907221-106907243 GCATCATAGGGTCCCCAGCAAGG - Intergenic
947530555 2:230906426-230906448 GCTTCCGAGGGTCCCCAGAGAGG + Intergenic
1168889338 20:1284117-1284139 GCACCAGAGGGTCCCCTCTAAGG - Intronic
1173401157 20:42727135-42727157 CCATCTGAGGTTCCCCACAATGG - Intronic
1174289317 20:49496477-49496499 CCATCAGAGGGTCCCCACAGAGG + Intergenic
1174915445 20:54648715-54648737 GCATTAGAGGGTCCTCAGCATGG + Intronic
1175339326 20:58218169-58218191 GCATTAGACGGTCCCCAGAAGGG + Intergenic
1175437603 20:58965398-58965420 GCAAAGGAGGGTCCCCGTAATGG - Intergenic
1185284509 22:49994269-49994291 CCATCCAAGTGTCCCCATAAAGG - Intergenic
950116554 3:10454214-10454236 GCACCTGGGGGTCCCCATGATGG - Intronic
950537018 3:13584614-13584636 GCATCCTGGGGTCCCCATACAGG - Intronic
951754267 3:26072640-26072662 GCATCAAAGGGTTCCTATAAGGG - Intergenic
952624873 3:35392097-35392119 CCATCAGAGGTTCTCCATGAGGG + Intergenic
952744188 3:36762531-36762553 GCTTCAGAGTGTCCCAATCAAGG + Intergenic
955098279 3:55821795-55821817 TCATCAGATAGTCTCCATAAAGG - Intronic
961524585 3:127488674-127488696 CCATCACAGGGTCCTCAGAATGG - Intergenic
962499492 3:135975375-135975397 CCACCAGAGGGCCCACATAAAGG - Intronic
966596225 3:181726572-181726594 GCCTCAGACGGTCACCATATTGG + Intergenic
969522871 4:7688991-7689013 ACATAAGAGGCTCCCAATAAAGG + Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
970475738 4:16420960-16420982 GCCTCAGAGGGTCACCACAGGGG + Intergenic
970655911 4:18229717-18229739 GTAGCAGAGGTTCTCCATAAGGG + Intergenic
972220599 4:36950136-36950158 CTAGCAGAGGGTCTCCATAAGGG + Intergenic
975878242 4:78869069-78869091 CTAGCAGAGGTTCCCCATAAGGG + Intronic
978630708 4:110740335-110740357 GCATTAAAGAGTCCTCATAAGGG + Intergenic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
984768994 4:183421492-183421514 AGATCAGAGGGTCCAGATAAAGG + Intergenic
986239775 5:5950728-5950750 GCATCAGAGGCTTCACATCATGG - Intergenic
987851572 5:23361940-23361962 CTAGCAGAGGTTCCCCATAAGGG + Intergenic
988359106 5:30212456-30212478 GTAGCAGAGGTTCTCCATAAGGG - Intergenic
996090732 5:119349078-119349100 GCATGAGAGGGGCCACAGAAGGG - Intronic
997811432 5:136974313-136974335 GGACCCTAGGGTCCCCATAAAGG + Intergenic
1007956851 6:45925994-45926016 TCATCTTAGGGTCCCCACAATGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1012634460 6:101518857-101518879 CCAACAGAGTGTCCCCTTAAAGG + Intronic
1016303018 6:142652732-142652754 GCAGCAGAGAGTCCCCTGAATGG - Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1024763401 7:52628285-52628307 CCATCAGATGGTCCCAAGAAGGG - Intergenic
1031965442 7:128024890-128024912 ACCACAGAGGTTCCCCATAATGG - Intronic
1033316861 7:140304648-140304670 CCTTCAGAGCCTCCCCATAAGGG + Intronic
1034431833 7:151045072-151045094 GTTTCAGAGTGTCCCCAGAAGGG + Intronic
1035728748 8:1840590-1840612 ACATCAGACAGTCCCCATATCGG - Intronic
1039918345 8:41875918-41875940 GCATCCGAGGCTCCCCAGAGGGG + Intronic
1041074995 8:54161248-54161270 CCAGCAGAGGTTCTCCATAAGGG - Intergenic
1042992377 8:74655669-74655691 CTAGCAGAGGGTCTCCATAAGGG - Intronic
1045258076 8:100546569-100546591 CCAGCAGAGGTTCTCCATAAGGG - Intronic
1046805856 8:118478261-118478283 CCATCAGAGTGTTCCCATTAAGG + Intronic
1046831482 8:118751361-118751383 CTAGCAGAGGTTCCCCATAAGGG - Intergenic
1048802011 8:138202659-138202681 GCATCAGAGGGTTGCTATTAGGG + Intronic
1050592258 9:7173114-7173136 CCATCAGGGGAACCCCATAAAGG - Intergenic
1051382273 9:16470817-16470839 GCAGCAGAGGTTCTCCATGAGGG - Intronic
1053311552 9:37023986-37024008 GCTTCAGAGGGTTCACAGAAGGG - Intronic
1057640786 9:96818936-96818958 ACATCAGAAGGTTCACATAAGGG - Exonic
1061210559 9:129189947-129189969 GCATCAGAGGGGCCCGGTGATGG + Intergenic
1185949988 X:4422146-4422168 GAATCAGAGATTCCCCACAAAGG - Intergenic
1186197202 X:7121334-7121356 TCAACAGAGGGTCCCCTTCAGGG - Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1202095832 Y:21247492-21247514 GCATCAGAGGGTGTCCAAAGAGG - Intergenic