ID: 913512418

View in Genome Browser
Species Human (GRCh38)
Location 1:119573833-119573855
Sequence TCACCTTACCCCACTGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913512418_913512425 20 Left 913512418 1:119573833-119573855 CCCCAGGCAGTGGGGTAAGGTGA No data
Right 913512425 1:119573876-119573898 CACTTCCAAGATGGCCGAATAGG 0: 11
1: 113
2: 357
3: 830
4: 1368
913512418_913512423 11 Left 913512418 1:119573833-119573855 CCCCAGGCAGTGGGGTAAGGTGA No data
Right 913512423 1:119573867-119573889 CCCAGTGGTCACTTCCAAGATGG No data
913512418_913512421 -4 Left 913512418 1:119573833-119573855 CCCCAGGCAGTGGGGTAAGGTGA No data
Right 913512421 1:119573852-119573874 GTGAAAAATGCAACACCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913512418 Original CRISPR TCACCTTACCCCACTGCCTG GGG (reversed) Intergenic
No off target data available for this crispr