ID: 913514906

View in Genome Browser
Species Human (GRCh38)
Location 1:119596360-119596382
Sequence GCATCAGAAGGCCCCCATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913514906_913514913 28 Left 913514906 1:119596360-119596382 CCCTTATGGGGGCCTTCTGATGC 0: 1
1: 0
2: 1
3: 6
4: 66
Right 913514913 1:119596411-119596433 ATTTGGCATGCTTTTCCTGAGGG 0: 1
1: 0
2: 0
3: 29
4: 246
913514906_913514911 11 Left 913514906 1:119596360-119596382 CCCTTATGGGGGCCTTCTGATGC 0: 1
1: 0
2: 1
3: 6
4: 66
Right 913514911 1:119596394-119596416 CTGCTTGATGTTATCATATTTGG 0: 1
1: 2
2: 17
3: 27
4: 193
913514906_913514912 27 Left 913514906 1:119596360-119596382 CCCTTATGGGGGCCTTCTGATGC 0: 1
1: 0
2: 1
3: 6
4: 66
Right 913514912 1:119596410-119596432 TATTTGGCATGCTTTTCCTGAGG 0: 1
1: 0
2: 5
3: 157
4: 3742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913514906 Original CRISPR GCATCAGAAGGCCCCCATAA GGG (reversed) Intergenic
904999206 1:34655131-34655153 GCATCAGAAGTCCTGCAGAATGG + Intergenic
906988230 1:50710067-50710089 GCATTTGAAGCCCTCCATAATGG - Intronic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
907373163 1:54016003-54016025 GCAAGAGAAGGCCCCCAGTATGG + Intronic
909489126 1:76207064-76207086 GAATCAGAAGTCCAACATAATGG - Intronic
911194092 1:94976394-94976416 GTCTCAGATGGCCCCCAGAACGG + Exonic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913510688 1:119558944-119558966 GCATCAGAGGGTCCCCATAAGGG - Intergenic
913514906 1:119596360-119596382 GCATCAGAAGGCCCCCATAAGGG - Intergenic
922343587 1:224677518-224677540 TCATCAGAAAGCACCCATGAAGG + Intronic
922726383 1:227924887-227924909 GCATCAGAGAGCCCTCATGAGGG + Intronic
1063409699 10:5827935-5827957 GCATCTGAAGGCCAGCATAGAGG + Intronic
1064406145 10:15065370-15065392 GCATCATAATGCCACCAAAATGG - Intronic
1066669519 10:37822013-37822035 ACAACATAAGCCCCCCATAAGGG + Intronic
1075583116 10:123637114-123637136 GCAGCAGATTGGCCCCATAATGG + Intergenic
1077435953 11:2539263-2539285 GCCCCAGAAAGACCCCATAATGG + Intronic
1079002993 11:16773380-16773402 GCATCAGCAGGTCCCAATAATGG - Intergenic
1080106716 11:28518767-28518789 ATATCAGAAGCCCCCCAGAAGGG + Intergenic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1089861388 11:121593117-121593139 GCATCAGAGGGCTCCAATACTGG - Intronic
1100355591 12:93826082-93826104 GCTTCAGAAGTCCCTCATAGAGG - Intronic
1107697063 13:43010835-43010857 GCATCACAAGGCCCAAATCAAGG - Intergenic
1113613023 13:111661399-111661421 TCAGCAGACGGCCCCCATTAGGG - Intronic
1119198787 14:72737784-72737806 GCATCAGAGGGAGCCCATGATGG - Intronic
1132702734 16:1229013-1229035 GCAGGTGAAGGTCCCCATAATGG - Exonic
1132705592 16:1241855-1241877 GCAGGTGAAGGTCCCCATAATGG + Exonic
1132834794 16:1947338-1947360 GCAGAAGAAGGCCCACATCATGG - Exonic
1137790110 16:51167831-51167853 GATTCAGATGGCCCCCATGAAGG - Intergenic
1143610899 17:8016766-8016788 GCCACAGAAGGCCCCGATTACGG - Intronic
1150565923 17:66339815-66339837 GCCTCTGAAGGCCACCAAAAAGG + Intronic
1157172647 18:45422279-45422301 GTATGAGAAGGTCCCAATAAAGG + Intronic
1158391052 18:57045184-57045206 GAATCAGAATGCCCCCAGAGCGG + Intergenic
1165921106 19:39298275-39298297 GCTCCAGGAGGCCCCCAAAAAGG + Exonic
925229889 2:2224288-2224310 GCAACAGATGGCACCCAGAAAGG + Intronic
928628461 2:33165608-33165630 GTATCAGAAGGTCCCCATACTGG - Intronic
932474239 2:71991517-71991539 GCAGCAGAGGGTCCCCATGAAGG - Intergenic
941388543 2:164882796-164882818 GTATCAGAAGGAACCCATGAAGG + Intergenic
945515413 2:210758382-210758404 GCCTCAGAAAGCCCCAATCATGG + Intergenic
1169445738 20:5669624-5669646 GCAGCTGGAGGCCCCCATAGAGG - Intergenic
1170490294 20:16865539-16865561 GCATTAGAAGTCTCTCATAATGG - Intergenic
1173335944 20:42112536-42112558 GCCTCAGGTGCCCCCCATAAGGG - Intronic
1173610871 20:44366933-44366955 GCATCAGAAGGCCCAGATCTGGG + Intronic
1175339326 20:58218169-58218191 GCATTAGACGGTCCCCAGAAGGG + Intergenic
1176274362 20:64255495-64255517 GCCTCAGAAGCCCTCCCTAAGGG - Intergenic
1176961809 21:15167253-15167275 GCATGAGAAGCCCTTCATAATGG - Intergenic
958883723 3:99702283-99702305 GTATCAGAAAGCCCACAAAAAGG + Intronic
959487068 3:106939064-106939086 GCAGCAGCAGGCCCCTATGAGGG + Intergenic
961659816 3:128462796-128462818 GGATGAGAAGGCCTCCATGAAGG + Exonic
962499492 3:135975375-135975397 CCACCAGAGGGCCCACATAAAGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
971030932 4:22635881-22635903 GCTTCAGAAGGCCGCCAGCAGGG + Intergenic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
984993323 4:185403364-185403386 GCCTCAGAAGGCCTCCACACAGG + Intronic
985413269 4:189709614-189709636 GGATCAGCATGCCCCTATAATGG + Intergenic
986298583 5:6460203-6460225 GCATCAGATGCCTCCCCTAAAGG + Intronic
986861863 5:11936173-11936195 GGATAAGAAGTCCCCCATCAAGG + Intergenic
992175340 5:74144113-74144135 GCAGCAGAAGGGCCCTCTAAGGG + Intergenic
992890936 5:81203331-81203353 GCAACAAAAGGCCCTCATACTGG - Intronic
998463462 5:142325543-142325565 GCAAGAGAAGGCCCCCAGTAGGG - Intronic
1001732010 5:173967699-173967721 GGATCAGCAGCCCTCCATAAGGG + Intergenic
1006262598 6:32887656-32887678 GCAGAAGAAGGCCCACATATTGG - Intergenic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1014897462 6:126920565-126920587 GCCACAGAAGGCCACCATATTGG - Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1024577963 7:50780324-50780346 GAAGCAAAAGGCCCACATAAAGG + Intronic
1025130759 7:56373264-56373286 GCATCAACAGGCCCCCGTGAGGG + Intergenic
1048431825 8:134377843-134377865 ACACCAGAATGCCCCCAAAATGG + Intergenic
1057640786 9:96818936-96818958 ACATCAGAAGGTTCACATAAGGG - Exonic
1062612394 9:137380794-137380816 GCACCAGAAGGCCCCCCCGAGGG + Intronic
1188410811 X:29870019-29870041 GCCTCAGAAGGCAGCCAGAAAGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1191963668 X:66731485-66731507 GCACCAGAAGGCAGCCATGAGGG - Intergenic
1195329629 X:103786513-103786535 CCAGCAGGAGGGCCCCATAAAGG - Exonic
1201311620 Y:12602926-12602948 CCATCATAAGGCCCCTATAGGGG - Intergenic