ID: 913517701

View in Genome Browser
Species Human (GRCh38)
Location 1:119618462-119618484
Sequence GTAGTTTTCTGCTGCTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913517701_913517705 8 Left 913517701 1:119618462-119618484 CCAGTCTAGCAGCAGAAAACTAC 0: 1
1: 0
2: 1
3: 3
4: 114
Right 913517705 1:119618493-119618515 GGGTACTTGCAGCTGTGATAGGG 0: 2
1: 0
2: 1
3: 4
4: 123
913517701_913517704 7 Left 913517701 1:119618462-119618484 CCAGTCTAGCAGCAGAAAACTAC 0: 1
1: 0
2: 1
3: 3
4: 114
Right 913517704 1:119618492-119618514 AGGGTACTTGCAGCTGTGATAGG 0: 2
1: 0
2: 1
3: 23
4: 144
913517701_913517706 17 Left 913517701 1:119618462-119618484 CCAGTCTAGCAGCAGAAAACTAC 0: 1
1: 0
2: 1
3: 3
4: 114
Right 913517706 1:119618502-119618524 CAGCTGTGATAGGGAGACAGAGG 0: 2
1: 0
2: 2
3: 33
4: 316
913517701_913517707 30 Left 913517701 1:119618462-119618484 CCAGTCTAGCAGCAGAAAACTAC 0: 1
1: 0
2: 1
3: 3
4: 114
Right 913517707 1:119618515-119618537 GAGACAGAGGAGCAAGCACTAGG 0: 1
1: 1
2: 3
3: 33
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913517701 Original CRISPR GTAGTTTTCTGCTGCTAGAC TGG (reversed) Intergenic
907871244 1:58445456-58445478 GCAGCTTCCTGCTGCTAGGCAGG - Intronic
908725815 1:67175763-67175785 GTAGTTTTCTTCTACTACTCTGG - Intronic
913255272 1:116947440-116947462 GGAGTTTACTGCTGAGAGACAGG - Intronic
913517701 1:119618462-119618484 GTAGTTTTCTGCTGCTAGACTGG - Intergenic
917306035 1:173626560-173626582 GTAGTGTTCTGGTTCTGGACTGG - Intronic
918776583 1:188639267-188639289 GTCACTTTCTGCTGCTAGAGTGG + Intergenic
922437236 1:225618552-225618574 GTAGTTCACTGATCCTAGACAGG + Intronic
923819348 1:237419696-237419718 CTACTTTCCTACTGCTAGACAGG - Intronic
1063965504 10:11343293-11343315 GTGGTTTTCAGCTGCAAGAGAGG - Intergenic
1065170486 10:23022551-23022573 GTTGCTTTCTGTTGCTAGGCTGG - Intronic
1072540150 10:96392247-96392269 GTATTTCTCTGATGCTAAACTGG - Intronic
1075297221 10:121288345-121288367 ATAGCTTTCTGCTTCTGGACTGG - Intergenic
1086692964 11:89809608-89809630 GTAGGTTTCAGATGCTAGAATGG - Intergenic
1086712837 11:90030051-90030073 GTAGGTTTCAGATGCTAGAATGG + Intergenic
1087231580 11:95672067-95672089 GTTGTATTCTGCTGCTTCACTGG + Intergenic
1087264250 11:96043341-96043363 GTACTTTTCTGTTCCTGGACAGG - Intronic
1089604651 11:119634928-119634950 CCAGTTTTCTGCTTCTAGCCTGG + Intronic
1089643596 11:119863854-119863876 GTCGTTTCCTGCTGCAAGCCAGG + Intergenic
1090458523 11:126869820-126869842 GGAGTTTTCTTCTGCTTAACTGG - Intronic
1098812768 12:75116943-75116965 GAAGCTTTCTTATGCTAGACTGG - Intronic
1099075887 12:78107706-78107728 GTAGTTTGTTACTACTAGACTGG + Intronic
1101104581 12:101427448-101427470 TCAGTTTTCTGCTGCTATAATGG + Intergenic
1107454474 13:40541582-40541604 ATAGTATTCTGCGACTAGACAGG - Intergenic
1108112938 13:47096263-47096285 TTAGTTTTCTGTTGGTATACAGG + Intergenic
1111852959 13:93600254-93600276 GTAAATTTCCTCTGCTAGACTGG - Intronic
1112334331 13:98501505-98501527 GTGGTTTTCTGCTCTTAAACTGG - Intronic
1118454815 14:65934989-65935011 GTATTTTTCTGGTGCTATGCAGG + Intergenic
1118459315 14:65974267-65974289 GTAGGTTCCTGCTGCTACCCAGG + Intronic
1121416123 14:93780271-93780293 GTAGCTTTCTGCCCCTAGAGGGG - Intronic
1127476326 15:59336845-59336867 TTGGTTTTCTGCTCCTAGGCTGG + Intronic
1128990716 15:72257553-72257575 GTAGTTTTCTCCTGATATAGAGG - Intronic
1138084101 16:54118166-54118188 GTAGTTTCCTGCTGAGAGATGGG + Exonic
1150853124 17:68724816-68724838 GAATCTTTCTGCTGATAGACTGG - Intergenic
1151118294 17:71763773-71763795 GCAGGTTTCTGCTGCTATCCAGG - Intergenic
1158078791 18:53563902-53563924 TTAGTTCACTGCTGCTAGATCGG - Intergenic
1158169305 18:54578265-54578287 ACAGTTTCCTTCTGCTAGACAGG + Intergenic
1159599168 18:70412241-70412263 GGAGATTTCAGCTGATAGACAGG + Intergenic
926591547 2:14745135-14745157 TTATTTTTCTGCTGGTAGAGGGG + Intergenic
926684704 2:15689920-15689942 TTGGTTTTCTCCTGCTAGAATGG - Intergenic
931722595 2:65078241-65078263 GTATTTTTCTGGTGGTAGTCTGG + Intronic
931893716 2:66704732-66704754 ATAATTTTTTGCTGCTAGAGTGG - Intergenic
932341123 2:70963158-70963180 GCAGGTCTCTGCTGCTAGAGAGG + Exonic
933706536 2:85295089-85295111 GGAGTTTTCTGCATCTACACAGG - Intronic
935348395 2:102130784-102130806 GTAGATTTCTGATGCCAGCCAGG + Intronic
937086962 2:119178139-119178161 GTGGTTTCCTGCTGCCAGAGAGG - Intergenic
937482713 2:122278889-122278911 CTAGTTTCCTGCTTCTATACAGG - Intergenic
937744947 2:125401252-125401274 GTAATTCTCTGCTTCAAGACTGG + Intergenic
938566082 2:132520405-132520427 GTAGATGTCTGCTGGTGGACTGG + Intronic
940742642 2:157527616-157527638 GTACTCTTCTGATTCTAGACTGG - Exonic
943151494 2:184119476-184119498 TTAATTTTCTGCTTTTAGACAGG - Intergenic
944855538 2:203763720-203763742 GTTGTTTTCTGATTCCAGACAGG + Intergenic
946760100 2:222984980-222985002 GTAGTTTGCTGCTGCTCACCGGG - Intergenic
946892171 2:224288670-224288692 GTAGTTTTCAGCTGCTAGATTGG + Intergenic
947384063 2:229572740-229572762 GCAGTTTTTTGCTGCACGACAGG + Intronic
948610412 2:239162981-239163003 GTAGTTTTCTGCTGCTCTCAAGG - Intronic
1169288117 20:4326376-4326398 GGGGGTTTCTGCTGCAAGACAGG + Intergenic
1173812488 20:45964596-45964618 GTAATGTTCTGCTTCTTGACTGG + Intronic
1174561909 20:51437060-51437082 GTAGTGTTCTGCTTCTGGACAGG - Intronic
1177306494 21:19324881-19324903 GAAGTTTTTTTCTGCTGGACTGG - Intergenic
1181886493 22:26026087-26026109 GTAGTTTGCTTCTTCAAGACCGG - Intronic
949262960 3:2123639-2123661 GTAGTTTTCTAGCGCTACACTGG + Intronic
950692540 3:14671627-14671649 GCAGTTTTCCACTGCTTGACAGG - Exonic
952991266 3:38832965-38832987 GCAGTTTTCTGGAGCTAGATGGG + Intergenic
954586652 3:51742576-51742598 GTAGTTTGCTGCTGCTGGCTGGG - Intergenic
957628640 3:82688751-82688773 TTAGTTTTCTGTTTCTATACTGG - Intergenic
958683898 3:97367583-97367605 GTAGTTTTCTGTTTCTAGCTTGG + Intronic
961689958 3:128662244-128662266 GCAGATTGCTGCTGCCAGACAGG + Intronic
964594040 3:158401368-158401390 GCAGTTTTCTGATGCTAGCCTGG - Intronic
965380120 3:167978272-167978294 GTAGATTCCTGATGCTAGGCAGG - Intergenic
967707502 3:192668558-192668580 CTGGTTTTCTGCTGGTACACAGG + Intronic
970389002 4:15588342-15588364 ATAGGTATCTGCTGCTAGCCTGG + Intronic
972591977 4:40496602-40496624 GTGGTTGTCTGCTGGTAGAGAGG - Intronic
976418408 4:84807165-84807187 GTATTTTTCTGTTGCTAAAATGG - Intronic
980211657 4:129796125-129796147 GTAGGTTTAGGCTCCTAGACTGG - Intergenic
990631486 5:57675158-57675180 GTAGTTATCTCATGGTAGACTGG + Intergenic
993244986 5:85439512-85439534 GTAGCTTTCTGCTGCAAACCAGG + Intergenic
994027800 5:95105188-95105210 TAAGTTTTCTGGAGCTAGACTGG - Intronic
1008072224 6:47109402-47109424 GTTGGTTTCTGCTGCTAGGGAGG + Intergenic
1009536442 6:64893959-64893981 GTAATTTTCTCCTGGTAGAGAGG - Intronic
1012908674 6:105095494-105095516 GCAGTTTTGTGCTGCTGCACTGG + Intergenic
1014981023 6:127946541-127946563 GTACTCTTATACTGCTAGACTGG + Intergenic
1016861490 6:148723047-148723069 CTAGTTTTCTGCTTGGAGACAGG - Intergenic
1017039470 6:150296149-150296171 GCAGTTTTCAGCAGCAAGACAGG - Intergenic
1017915883 6:158831356-158831378 GTTGTGTTTTGCTTCTAGACTGG + Intergenic
1019792121 7:3021952-3021974 TTGGTTTTCTGCAGCTGGACAGG - Intronic
1019839370 7:3424548-3424570 TTTGTTTTCTGCTGATAGTCTGG + Intronic
1022972901 7:35533522-35533544 GCAGTGTGCTGCTGCTGGACTGG - Intergenic
1024745590 7:52401901-52401923 ATAGTTTTTTCCTGATAGACAGG + Intergenic
1025818458 7:64941953-64941975 GTAGTTTTCAGCTACTGGACAGG + Intergenic
1028482015 7:91317415-91317437 GTATTCTTCTGGGGCTAGACAGG + Intergenic
1028715571 7:93963237-93963259 GCAGTTTTCTGCTTCTACAGAGG - Intronic
1030229501 7:107192229-107192251 GTAGTTTACTGTGCCTAGACTGG - Intronic
1031169752 7:118277911-118277933 GTAATTTTCTGAAGCCAGACAGG + Intergenic
1032083579 7:128872321-128872343 GTAGGATTCTGATGCTAAACTGG - Intronic
1034290377 7:149926399-149926421 GTAGTTCACTGCTCCTAGAGTGG + Intergenic
1034660696 7:152766442-152766464 GTAGTTCACTGCTCCTAGAGTGG - Intronic
1036713908 8:11102292-11102314 TTAGTTTACCGCTGCTAGAATGG + Intronic
1038076862 8:24085585-24085607 GTAGTTCACTGCTACTATACTGG + Intergenic
1041189348 8:55337838-55337860 GTAGTTTTCTTATTCTTGACAGG + Intronic
1041231926 8:55761384-55761406 TAAGATTTCTACTGCTAGACAGG - Intronic
1047684606 8:127292271-127292293 GCAGTTTGATGGTGCTAGACAGG + Intergenic
1047833055 8:128657240-128657262 GGAGTATTGTGCTGCCAGACAGG - Intergenic
1051147402 9:14041828-14041850 GAAGTTCTCTGCTCCCAGACAGG - Intergenic
1055100948 9:72465043-72465065 GTTGATGTCTGCTACTAGACCGG + Intergenic
1055443281 9:76357603-76357625 GGAGTTTTATGCTCCTAGCCTGG - Intronic
1058694211 9:107545739-107545761 GGGGTCTTCTGCTGCCAGACTGG + Intergenic
1061661061 9:132130632-132130654 GTATTATTCTGCTGCAAGAAAGG - Intergenic
1061708234 9:132469311-132469333 GTAGTTTTCTGGTGTTAGCAAGG + Intronic
1186691847 X:11985860-11985882 CTATTTTACTGCAGCTAGACTGG - Intergenic
1188083729 X:25877847-25877869 TTAGTTTTCTGCTTCTAAATTGG - Intergenic
1194327902 X:92542782-92542804 GTAGATTTCTGCCACTAGAGAGG - Intronic
1194393561 X:93351133-93351155 GTTGTATTCTGCTGTTATACAGG + Intergenic
1195805888 X:108764655-108764677 GTACTTTTGTGCTGCTAAAACGG + Intergenic
1196048867 X:111283910-111283932 GTCCTTTTATGCTACTAGACTGG - Intergenic
1196372189 X:114991829-114991851 GAAGTTGTCTCCTGCTAAACAGG - Intergenic
1197833307 X:130668477-130668499 GTAGATTTCTGCAGCTAGTTAGG + Intronic
1197986005 X:132267103-132267125 GCAGTTATCTGCTTCTGGACAGG - Intergenic
1199377411 X:147130026-147130048 GTTGTTTTCTGCTTCTAGGATGG + Intergenic
1200636615 Y:5661993-5662015 GTAGATTTCTGCCACTAGAGAGG - Intronic