ID: 913520856

View in Genome Browser
Species Human (GRCh38)
Location 1:119644970-119644992
Sequence CTGTTTCCATTCAATTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913520856_913520857 -4 Left 913520856 1:119644970-119644992 CCTTCATAATTGAATGGAAACAG No data
Right 913520857 1:119644989-119645011 ACAGTTACCTTCTTCAGTCTAGG 0: 1
1: 0
2: 0
3: 6
4: 160
913520856_913520860 29 Left 913520856 1:119644970-119644992 CCTTCATAATTGAATGGAAACAG No data
Right 913520860 1:119645022-119645044 AAATTGTTGATTATTTGCTTGGG 0: 1
1: 0
2: 4
3: 59
4: 574
913520856_913520859 28 Left 913520856 1:119644970-119644992 CCTTCATAATTGAATGGAAACAG No data
Right 913520859 1:119645021-119645043 AAAATTGTTGATTATTTGCTTGG 0: 1
1: 0
2: 4
3: 47
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913520856 Original CRISPR CTGTTTCCATTCAATTATGA AGG (reversed) Intronic
No off target data available for this crispr