ID: 913522041

View in Genome Browser
Species Human (GRCh38)
Location 1:119653908-119653930
Sequence GGTGGGGGAGGAGAATTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913522041_913522048 2 Left 913522041 1:119653908-119653930 CCATTAAATTCTCCTCCCCCACC No data
Right 913522048 1:119653933-119653955 TTTATTTATCTGATTTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913522041 Original CRISPR GGTGGGGGAGGAGAATTTAA TGG (reversed) Intergenic
No off target data available for this crispr