ID: 913522048

View in Genome Browser
Species Human (GRCh38)
Location 1:119653933-119653955
Sequence TTTATTTATCTGATTTGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913522042_913522048 -10 Left 913522042 1:119653920-119653942 CCTCCCCCACCATTTTATTTATC No data
Right 913522048 1:119653933-119653955 TTTATTTATCTGATTTGAATTGG No data
913522041_913522048 2 Left 913522041 1:119653908-119653930 CCATTAAATTCTCCTCCCCCACC No data
Right 913522048 1:119653933-119653955 TTTATTTATCTGATTTGAATTGG No data
913522040_913522048 26 Left 913522040 1:119653884-119653906 CCTTGCACTTTTTAGTTCTGGGA No data
Right 913522048 1:119653933-119653955 TTTATTTATCTGATTTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913522048 Original CRISPR TTTATTTATCTGATTTGAAT TGG Intergenic
No off target data available for this crispr