ID: 913528183

View in Genome Browser
Species Human (GRCh38)
Location 1:119713220-119713242
Sequence GTGGTGGACAGGGCTGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 721
Summary {0: 1, 1: 0, 2: 8, 3: 71, 4: 641}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913528183_913528196 20 Left 913528183 1:119713220-119713242 CCCGCCTCAGCCCTGTCCACCAC 0: 1
1: 0
2: 8
3: 71
4: 641
Right 913528196 1:119713263-119713285 GAGGACCCCTTAGACCGCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 77
913528183_913528191 1 Left 913528183 1:119713220-119713242 CCCGCCTCAGCCCTGTCCACCAC 0: 1
1: 0
2: 8
3: 71
4: 641
Right 913528191 1:119713244-119713266 TTCAGCCGTCTCCTCCTCCGAGG 0: 1
1: 0
2: 0
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913528183 Original CRISPR GTGGTGGACAGGGCTGAGGC GGG (reversed) Intronic
900136607 1:1120338-1120360 GTGGTGAGCAGGGGTGGGGCGGG + Intergenic
900386586 1:2413482-2413504 GGGGTGGGAAGGGCTGGGGCGGG + Intronic
900552851 1:3265176-3265198 GTGGTGGACAGGGATGAGACAGG + Intronic
900743802 1:4346507-4346529 GGGGTGGACAGGGCTGAGGAAGG + Intergenic
901399450 1:9005978-9006000 GTGGTGGACAGGAGGAAGGCAGG - Intronic
901483194 1:9539898-9539920 CTGGTGGGCAGGGCCGAGGGAGG + Intronic
901890482 1:12259281-12259303 GGGGTGGTGAAGGCTGAGGCAGG - Intronic
902351556 1:15859504-15859526 GTGGTGGCGGGGGCTGTGGCGGG - Intronic
902471274 1:16648694-16648716 TTGGTGGTGAGGGCTGAGGCAGG - Intergenic
902515386 1:16986993-16987015 GGGGTGGACAGGGAAGGGGCGGG + Intronic
902779084 1:18693017-18693039 TGGCTGGAAAGGGCTGAGGCTGG + Intronic
902837917 1:19058606-19058628 GAGGTGGACAGGGCTTAGACAGG - Intergenic
902940459 1:19797225-19797247 GTGGTGTACAGGGTACAGGCAGG + Intronic
903279394 1:22242001-22242023 GTGTGGGCCAGGGCTGAGGAGGG + Intergenic
903484943 1:23682675-23682697 GTGGTGGAAGAGGCTAAGGCAGG - Intergenic
903563491 1:24246625-24246647 TTGGGGGAGAGGGCTCAGGCAGG - Intergenic
903619259 1:24686012-24686034 GGGGTGGCCAGGGCGGGGGCCGG + Intergenic
903698955 1:25232186-25232208 CTGGTGGACAGCGCGGAGGAGGG - Exonic
903736026 1:25530374-25530396 CGGGGGGACAAGGCTGAGGCTGG + Intergenic
903938563 1:26913364-26913386 GTGGGGGGCAAGGCTGAAGCAGG - Intronic
903969118 1:27107625-27107647 GTGAGGGCCAGGGCTGGGGCGGG - Intronic
904013582 1:27404135-27404157 GTGGTGGCCAGAGCTCAGGAGGG - Intergenic
904143328 1:28370247-28370269 GGGGTGCAGAGGTCTGAGGCAGG - Intronic
904286731 1:29457700-29457722 GTGGAAGACAGGGCTGAGAAGGG - Intergenic
904327256 1:29734906-29734928 GTGGGGGTCAGGGGAGAGGCGGG + Intergenic
904468950 1:30723935-30723957 GTGCAGGACAGGGCTGGGCCGGG - Intergenic
904619647 1:31767519-31767541 GTGGTGAACAGGGCTGAGTGAGG - Intergenic
904632306 1:31851701-31851723 GTGGTGGCGGGGGCTGAGGCAGG - Intergenic
904772262 1:32886801-32886823 CTGGGGGACAGAGCTGAGGGAGG + Intronic
904927836 1:34062538-34062560 GTGGTGAAGAGGGCAGAGGGAGG + Intronic
905127961 1:35729212-35729234 GGGGTAGAAAGTGCTGAGGCAGG - Intronic
905168892 1:36098653-36098675 TTGGGGGACAGGGGTGAGCCAGG - Exonic
905296259 1:36956222-36956244 TTGGAAGACAGGGCTGAGGGTGG + Intronic
905733527 1:40311789-40311811 AGGGTGGAGAGGGCAGAGGCAGG - Intronic
906263070 1:44407589-44407611 GTGGCCGACAGGGCCGGGGCCGG + Intronic
906472571 1:46143559-46143581 GTGGTGGGGAGGGCAGAGGTGGG - Intronic
906549597 1:46652580-46652602 CTGTTGGACAGGACTGAGCCCGG + Exonic
906642980 1:47452575-47452597 GTTGGGGATAGGGCAGAGGCGGG + Intergenic
906704499 1:47885088-47885110 GAGGTGGCAAGAGCTGAGGCTGG - Intronic
907018483 1:51041552-51041574 GTAGAGCCCAGGGCTGAGGCTGG + Intergenic
907090767 1:51723312-51723334 GTGGTTGCCAGGGATGAGGGAGG - Intronic
907239987 1:53075983-53076005 GGGGTGGTCAGGGCTCGGGCTGG + Intronic
907988156 1:59553225-59553247 GGGGTGGAAAGTGCTCAGGCAGG - Intronic
908454738 1:64292100-64292122 GTGGTGGACGGGGTGGGGGCGGG + Intergenic
910207214 1:84759864-84759886 GTGGAGGGGAAGGCTGAGGCCGG + Intergenic
910220570 1:84885753-84885775 GTGGTGGACACAGAGGAGGCAGG + Intronic
911108051 1:94152819-94152841 GTGGCAGGCAGGGCTGAGCCAGG - Intronic
911110252 1:94176176-94176198 GTGGCAGGCAGGGCTGAGCCAGG - Intronic
912946878 1:114092756-114092778 GTGAAGGACAGGGCTGAGGCTGG + Intronic
913282835 1:117201962-117201984 CTGGTGGAAAGCCCTGAGGCAGG - Intronic
913528183 1:119713220-119713242 GTGGTGGACAGGGCTGAGGCGGG - Intronic
913529159 1:119721245-119721267 GTGGTGGGCAGGGCTGGCACAGG + Exonic
914415959 1:147482404-147482426 GTGGAGGACAGGACTGACCCTGG - Intergenic
914678741 1:149923913-149923935 GTGGTGGTCGGGGCGGTGGCTGG + Exonic
915047043 1:153026679-153026701 GTGGTGGACAGTGGTGAGGCGGG - Intergenic
915325482 1:155079505-155079527 GTGGGGTCCAGAGCTGAGGCAGG + Intronic
915457639 1:156051256-156051278 GTGGTGGAGGGTGCTGAGGCAGG + Exonic
915913922 1:159930226-159930248 GTGCTGGACCCGGCTGTGGCAGG - Exonic
916484812 1:165249374-165249396 GTGGTGGGCAGGGCTGCGGTGGG - Intronic
919135008 1:193496797-193496819 CTGGTGGTGAGTGCTGAGGCAGG + Intergenic
919529779 1:198702450-198702472 GTGGTGTGCAAGGCTGAGGGTGG - Exonic
919765430 1:201124350-201124372 GTGGTTCAGAGGGCAGAGGCTGG - Intronic
919805786 1:201380393-201380415 TTGGAGGACAAGGCTGGGGCAGG - Intronic
919981081 1:202643309-202643331 CTGGTGGAGAGGGCGGGGGCGGG + Exonic
920455727 1:206099700-206099722 ATGGTGGCCAGGGCTGGGCCTGG - Exonic
920855047 1:209655183-209655205 ATGGGGGACAGGGATGGGGCAGG - Intergenic
920947499 1:210543586-210543608 GGGGTGGGGAGGGTTGAGGCAGG - Intronic
921165281 1:212502508-212502530 ATGGAGGAGATGGCTGAGGCAGG + Intergenic
921934280 1:220782110-220782132 GGGGTGGAGAAGGCTGAGGTAGG - Intronic
922344483 1:224684927-224684949 CTGGTGGACAGGACTGGAGCAGG - Intronic
923093079 1:230754086-230754108 GGTGAGGCCAGGGCTGAGGCAGG + Intronic
923103830 1:230838866-230838888 GTGGTGGTCAGGGCTGGGGAAGG + Exonic
923203821 1:231738972-231738994 GCTGAGGCCAGGGCTGAGGCAGG - Intronic
923717647 1:236438456-236438478 GTGGTGACCAGGGCTGTGGTGGG + Intronic
924414806 1:243849189-243849211 GAGGTGGACAAGGAAGAGGCTGG + Intronic
924566807 1:245205817-245205839 GTGGGGGAGAGTGCTGAGTCAGG - Intronic
1063118178 10:3085774-3085796 GTGGGGGACTGTGCTGAGGAGGG - Intronic
1063401323 10:5748816-5748838 GAGGGGCTCAGGGCTGAGGCTGG + Exonic
1063505020 10:6589991-6590013 GGGGTGGACAGGGAGGAAGCAGG - Intergenic
1063979985 10:11445018-11445040 GTGGGGGACAGGGGAGACGCGGG - Intergenic
1064622452 10:17229411-17229433 CTGGTGGACATGGCTGCGGAGGG - Exonic
1065101243 10:22335079-22335101 CTGGGTGACAGGGCTGAGGAGGG + Intergenic
1065126623 10:22580037-22580059 GGGGTGGAGAGGGCAAAGGCAGG + Intronic
1065258318 10:23897505-23897527 ATGGTGGCCAGGGCTGAGACTGG + Intronic
1065364095 10:24918023-24918045 GTGGTAGAAGGGGATGAGGCTGG + Intronic
1065412904 10:25450022-25450044 GTGGTGGACATGGCAGTGTCAGG - Intronic
1065732417 10:28721698-28721720 GCGGTGGGCAAGGCTGAGGATGG + Intergenic
1065852983 10:29806029-29806051 GCAGGGGACAGGGGTGAGGCAGG + Intergenic
1066093934 10:32055599-32055621 GGAGTGTCCAGGGCTGAGGCTGG + Intronic
1066104696 10:32146240-32146262 GTGGTGGCCAGGTCTGAGAGTGG - Intergenic
1066281773 10:33924713-33924735 GTGGGGGGCAGGGCTGAGGTGGG - Intergenic
1066371572 10:34822182-34822204 GTGCTGGAGAGGCTTGAGGCTGG - Intergenic
1067147594 10:43704421-43704443 GTGGTTGGCTGGGCTGAGGAAGG - Intergenic
1067217675 10:44316533-44316555 GTGGTGGGAAGGGCCGAGGATGG - Intergenic
1067217702 10:44316608-44316630 GTGGTGGGAGGGGCTGAGGCTGG - Intergenic
1067217759 10:44316760-44316782 GTGGTGGGAGGGGCTGAGGGTGG - Intergenic
1067217767 10:44316779-44316801 GTGGTGGGAGGGGCTGAGGGTGG - Intergenic
1067228317 10:44389611-44389633 TTGCTGGACAGTGCTGAGGCAGG + Intergenic
1067427069 10:46218499-46218521 ATGGTGGAGTGAGCTGAGGCTGG + Intergenic
1067427163 10:46218993-46219015 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067427172 10:46219031-46219053 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067582589 10:47454823-47454845 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067932399 10:50575971-50575993 GTAGTGGACATAGCTCAGGCAGG - Intronic
1068392605 10:56417607-56417629 GTGGTAGAGAGTGCAGAGGCGGG + Intergenic
1069866389 10:71506212-71506234 GTGGTTGCCAGGGCTGGGGAAGG + Intronic
1069880595 10:71590337-71590359 GTGGTGGGGAGGGGTAAGGCTGG - Intronic
1070248168 10:74751059-74751081 GATGTGGAGAGGGCTGAGGGTGG - Intergenic
1070942741 10:80360869-80360891 GTTGGGGGCAGGGCTGAGGTGGG - Intronic
1072448866 10:95522890-95522912 GAGGTGGACAGGAGTGAGACAGG + Intronic
1072615082 10:97043750-97043772 ATGGGGGACAGGGCAGTGGCAGG - Intronic
1073082074 10:100866665-100866687 GTGGTGGCAGCGGCTGAGGCTGG + Intergenic
1073139418 10:101237523-101237545 CTAGGGGACAGGGCTGTGGCGGG - Intergenic
1073318618 10:102600167-102600189 GTGATAGGCAGGGCTGAAGCTGG + Intronic
1073326489 10:102646379-102646401 GTGGAGGCCAGTGCGGAGGCTGG + Intronic
1075006841 10:118836838-118836860 TTGGTAGGCAGGGCTCAGGCTGG - Intergenic
1075484478 10:122811055-122811077 GTGGTGGACAGAGGTGATCCTGG - Intergenic
1076133394 10:128028834-128028856 GGGGTGGCCAGGGCTGGGCCGGG - Intronic
1076394514 10:130129061-130129083 GTGGGTGACAGGGCTGGGGGCGG + Intergenic
1076715629 10:132362472-132362494 CTGGTGGACAGAGCAGAGTCGGG + Intronic
1076808039 10:132869128-132869150 TTGGGGGACACGGCTGTGGCCGG - Intronic
1076890513 10:133280976-133280998 GTGCTGGACTGAGCTGAGGAAGG + Intronic
1076890570 10:133281170-133281192 GTGCTGGACTGAGCTGAGGAAGG + Intronic
1076988135 11:253988-254010 ATGGAGGACAGGTTTGAGGCTGG - Intergenic
1077044074 11:536797-536819 GCGCTGGACTGGGCAGAGGCAGG - Intronic
1077075766 11:701289-701311 GAGGAGGGGAGGGCTGAGGCAGG - Intronic
1077261668 11:1625124-1625146 GTGGCTGTCAGGGCTGAGGAGGG + Intergenic
1077299566 11:1840742-1840764 GGGGTGGTCAGGGCAGGGGCAGG + Intronic
1077331802 11:1987243-1987265 GGGGTGGGCAGGGCTGAGCTGGG + Intergenic
1077369754 11:2175979-2176001 GTGGTGGGCAAGGCTGGTGCTGG - Intergenic
1077495682 11:2885554-2885576 GAGGAGGAGAGGGCGGAGGCCGG + Exonic
1077541567 11:3149028-3149050 GGGGAGGTCAGGGCTGGGGCAGG - Intronic
1078164617 11:8871255-8871277 GTGGGGGACAGGGGTGAGGGAGG + Intronic
1078402083 11:11037389-11037411 GGGCTGGGCTGGGCTGAGGCTGG + Intergenic
1078897046 11:15605963-15605985 GTGGTGGACAGAGCTCAACCAGG + Intergenic
1079079855 11:17406674-17406696 GGAGTGGACAGGGCTGAAGGTGG - Exonic
1079335109 11:19564259-19564281 CTGGGGGAATGGGCTGAGGCTGG + Intronic
1080255857 11:30289601-30289623 GATGTGGACAGGTCTGAGGTGGG - Intergenic
1080653819 11:34243002-34243024 GAGGTGGGCAGGGCTGTGGAGGG - Intronic
1081574974 11:44313369-44313391 GTGGTGGAGAGGGTTGGGGTGGG + Intergenic
1081619041 11:44607996-44608018 GTGGTGGACTAAGGTGAGGCAGG - Intronic
1081695696 11:45107620-45107642 GTGGGGGACAGGGCAGGGGTAGG + Intronic
1081871693 11:46385611-46385633 GTGGTGGACAGCTCTGTGGCTGG + Exonic
1082095606 11:48127009-48127031 GTGGTGGACACAGCTGTGTCAGG + Intronic
1082160427 11:48883245-48883267 GAGGTGCACAGGGCTGGGGGTGG + Intergenic
1082161939 11:48897161-48897183 GAGGTGCACAGGGCTGGGGGTGG - Intergenic
1083406704 11:62462283-62462305 GTGCTAAAGAGGGCTGAGGCAGG - Intronic
1083726016 11:64628648-64628670 GTGCTGGACAGGGCTGGGCTTGG - Intronic
1083728841 11:64642618-64642640 GTGGTGGGTGGTGCTGAGGCTGG + Intronic
1083802091 11:65052737-65052759 GAGGTGGACAGGGCTGGGCGAGG - Intronic
1083957474 11:65993131-65993153 GTGGAGGACTGGGGTGGGGCAGG - Intergenic
1084038700 11:66529455-66529477 GTGGTGGTCAGAGCTGTGGCAGG + Intronic
1084063489 11:66690338-66690360 GTGGCAGCCAGGACTGAGGCAGG - Intronic
1084413697 11:69018219-69018241 GAGGTGGACAGGGCAGAGGAGGG - Intergenic
1084420461 11:69058111-69058133 GCGGTGGAAAGGGCTGAGTGTGG - Intronic
1084548861 11:69828856-69828878 GTGTGGGACAGGGCCTAGGCAGG - Intergenic
1084673720 11:70622354-70622376 GGGGTGGAGAGGACTGAGGCTGG - Intronic
1087152211 11:94869257-94869279 ATGGAGGACAGTGCTGAGGTGGG - Exonic
1089447533 11:118565489-118565511 GGGGTGGGGTGGGCTGAGGCGGG + Intronic
1089551276 11:119280651-119280673 GTGCTGGAGGGGGCAGAGGCAGG - Intronic
1089616655 11:119698599-119698621 ATGGTGGACAGACCTGGGGCTGG + Intronic
1089620093 11:119717242-119717264 GCTGTGGTCAGGGCAGAGGCAGG + Intronic
1089851000 11:121496382-121496404 GTAGGGGACAGGGCAGAGACAGG + Intronic
1090076889 11:123585228-123585250 GTGAAGGACAGAGCTGAGGAGGG + Intronic
1090177818 11:124666932-124666954 GAGGTGGGCAGAGATGAGGCAGG - Intronic
1090373990 11:126276322-126276344 GGGGTGGACAGGGTTGGGGAGGG + Intronic
1090416677 11:126545270-126545292 GTGGTGGACGGGAGTGAGCCAGG + Intronic
1091215140 11:133896734-133896756 GTGGTAGCCTGAGCTGAGGCAGG + Intergenic
1091281033 11:134381806-134381828 GTGGAGGACAGGGCAGATGTGGG - Exonic
1091305267 11:134532352-134532374 CTGGAGGGCCGGGCTGAGGCTGG + Intergenic
1202814783 11_KI270721v1_random:42419-42441 GGGGTGGGCAGGGCTGAGCTGGG + Intergenic
1091748027 12:3004962-3004984 GTGCTGGTCAGGGGTGATGCCGG - Intronic
1091831067 12:3551516-3551538 GTGGGGGACAGGGCTGAGCATGG + Intronic
1093153514 12:15652275-15652297 GTGGCTGACAAGGATGAGGCAGG + Intronic
1096094489 12:48925346-48925368 GCGGTGTGCCGGGCTGAGGCTGG - Exonic
1096215619 12:49796226-49796248 GTGGTGGACAAGGCTGACTGCGG + Exonic
1096220559 12:49826137-49826159 GAGGTGGGCAGGGCTGGGGGTGG + Intronic
1097145498 12:56936805-56936827 GTGGCAGAAAGGGCTGAGACAGG + Intergenic
1097755087 12:63399690-63399712 GTTGGGGAAAGAGCTGAGGCAGG - Intergenic
1098973608 12:76879374-76879396 GCGGTGGACAGGTCCGACGCAGG - Intergenic
1099043243 12:77682141-77682163 GTGGTGGCCAGGGGCGAGGTGGG - Intergenic
1099259610 12:80361143-80361165 GTGGTTACCAGGGCTGAGGGTGG - Intronic
1101766048 12:107700353-107700375 GTGGTTGCCAGGGCTGGGGGTGG - Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102152384 12:110697760-110697782 GTACTAGGCAGGGCTGAGGCAGG - Intronic
1102157781 12:110744210-110744232 CTGGTGGACAGAGCTGTAGCAGG - Intergenic
1102562099 12:113769563-113769585 GGGGTAGGTAGGGCTGAGGCTGG + Intergenic
1103477492 12:121229391-121229413 ATGGAGGTCATGGCTGAGGCAGG - Intronic
1103507532 12:121452130-121452152 GTGGTTGCCCGGGCTGAGGGAGG + Intronic
1103518342 12:121521677-121521699 GTGGAGGGCAGAGCTGAGGGGGG - Intronic
1103568482 12:121829103-121829125 GGGGTGGGCAGGGCTGAGGGTGG + Intronic
1103722508 12:122982266-122982288 GTTGTTGGCCGGGCTGAGGCTGG + Intronic
1103987707 12:124778637-124778659 GTGGTGGGCGGGGATGAGGGTGG - Intronic
1104109795 12:125694493-125694515 GTGTTACAAAGGGCTGAGGCAGG - Intergenic
1104691906 12:130832875-130832897 GCTGTGGACAGGGCTGGGGGAGG - Intronic
1104714719 12:131008760-131008782 CAGGTGGACGGGGCTGAGACTGG + Intronic
1104761345 12:131299068-131299090 CAGGTGGGCAGGGCCGAGGCGGG + Intergenic
1104818430 12:131661724-131661746 CAGGTGGGCAGGGCCGAGGCGGG - Intergenic
1104897209 12:132170362-132170384 GTGGCGGCCAAGGCTGGGGCTGG - Intergenic
1104927638 12:132321939-132321961 GTGGTGCAGGGGGCCGAGGCGGG - Intronic
1105346895 13:19581551-19581573 GTGGTGGACGGGGCTCAGCTAGG + Intergenic
1105535273 13:21259792-21259814 CTGGTGGGCAGGCCTGGGGCAGG + Intergenic
1106485232 13:30166611-30166633 GTGGGAGACAAGGCTGAGGAGGG + Intergenic
1106577783 13:30991930-30991952 GCGGTGGCGAGCGCTGAGGCAGG + Intergenic
1106887142 13:34199344-34199366 GTGGTTATCAGGGCTGAGGGGGG + Intergenic
1107549715 13:41463501-41463523 GTGGTGGGCAGGGCGGGGGCGGG + Intronic
1107624858 13:42272081-42272103 GGGGTGGGCAGGGCGGGGGCGGG + Intergenic
1108297956 13:49044131-49044153 GGGATGAAAAGGGCTGAGGCTGG + Intronic
1108709100 13:53015808-53015830 GAGATGGAGAGGGATGAGGCAGG - Intergenic
1110276941 13:73651456-73651478 TGGGAGGACAAGGCTGAGGCAGG + Intergenic
1111213248 13:85108571-85108593 CTGGTGCACAGGGCGGAGGCAGG - Intergenic
1112015412 13:95327354-95327376 GTGGTGGGGAGTGCTGAGGGTGG - Intergenic
1112516037 13:100054152-100054174 TTGGGGGGTAGGGCTGAGGCAGG - Intergenic
1113549015 13:111177233-111177255 ATTGTGGCCGGGGCTGAGGCTGG + Intronic
1113850351 13:113414213-113414235 GTGTGTGACATGGCTGAGGCTGG - Intergenic
1113918271 13:113887736-113887758 GTGGTTGCCAGGGGTGAGGGAGG - Intergenic
1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG + Exonic
1114771467 14:25431834-25431856 GTGGTGGGCACGACTGTGGCGGG - Intergenic
1115057888 14:29152905-29152927 TGGGTGTACAAGGCTGAGGCAGG + Intergenic
1116614632 14:47119160-47119182 GGGGGGGGCGGGGCTGAGGCAGG - Intronic
1116867192 14:50040421-50040443 GTGGTGAGCAGGGGTGAGGGAGG - Intergenic
1117376929 14:55125740-55125762 GAGGTGGCCAGGGCTGAGGTTGG + Intronic
1117492907 14:56270061-56270083 GTGCTGGACAGGGCTGGGGCAGG - Intronic
1117646749 14:57861170-57861192 GTGGAGGACATGGTAGAGGCTGG - Intronic
1118683659 14:68269341-68269363 GCAGTGGGCAGGGCTGAGTCAGG - Intronic
1118710195 14:68512569-68512591 GTGGGGGCCAGGGCAGAGGTGGG - Intronic
1118870442 14:69736789-69736811 GGGGTGGACAGGGAGGAAGCAGG + Intronic
1119078787 14:71672467-71672489 CTGGCAGGCAGGGCTGAGGCAGG + Exonic
1119545788 14:75470359-75470381 GGGGTGGCCAGGGCGGGGGCGGG + Exonic
1120223537 14:81763881-81763903 GTGGCTCACAAGGCTGAGGCGGG - Intergenic
1120845218 14:89119307-89119329 TTGGAGGACAGGGCTGGGGTGGG + Intergenic
1121026000 14:90616539-90616561 GCGGTGGGCAGGGCAGGGGCTGG + Intronic
1121428879 14:93873164-93873186 GAGGTGTACAGAGCTGAGGGGGG + Intergenic
1121432936 14:93900208-93900230 GTGGTGGACGGAGGTGAGGCTGG + Intergenic
1121762098 14:96454588-96454610 TTGGTGGCCCAGGCTGAGGCAGG - Intronic
1122112029 14:99509909-99509931 GGTGTGGTCAGGGCTGAGGGAGG + Exonic
1122254298 14:100465366-100465388 GTGGTGGCCAGGGCTGGGGGAGG - Intronic
1122790896 14:104183761-104183783 TGGATGGCCAGGGCTGAGGCGGG + Intergenic
1122940080 14:104977314-104977336 TTGGAGGGCAGGGCTGAGGGGGG - Intronic
1123036531 14:105474157-105474179 GTGGAGGGCAGGGCTCAGGAAGG - Intronic
1124453653 15:29821863-29821885 GGGGTGGGCAGGGCTGGCGCGGG - Intronic
1124496780 15:30192051-30192073 CTGGTGGAGAGGGCGGGGGCGGG + Intergenic
1124746796 15:32346596-32346618 CTGGTGGAGAGGGCGGGGGCGGG - Intergenic
1125545077 15:40497511-40497533 GTGGTAGACATGGCAGAGGCAGG - Intergenic
1126675670 15:51157756-51157778 GTGGGAGGCAGGGCTGGGGCTGG + Intergenic
1126996664 15:54452386-54452408 GTGTTGAACATGGCTGAGACAGG + Intronic
1127631449 15:60831499-60831521 CTGGAGGTCAGGTCTGAGGCAGG + Intronic
1127686272 15:61348558-61348580 ATGGTGGACATGGCAGAAGCTGG - Intergenic
1127848364 15:62891392-62891414 GTGGAGAACAGGGCTGTGGTGGG - Intergenic
1127978870 15:64019186-64019208 GAGGTGGGCAGGTCTGAGACAGG - Intronic
1128062785 15:64745821-64745843 GTGGAGGCCTGGGCTCAGGCTGG + Intronic
1128497320 15:68205971-68205993 GTGGTGGAGGGGCCTGAGCCGGG + Intronic
1128510732 15:68312652-68312674 GTGGGTGGCAGGGTTGAGGCTGG + Intronic
1128830455 15:70763550-70763572 GACGTCGACAGGCCTGAGGCGGG + Exonic
1128939759 15:71778522-71778544 GTGGGGGAGGCGGCTGAGGCAGG - Exonic
1129258399 15:74347831-74347853 GCTGTGGAGAGGGCAGAGGCTGG - Intronic
1130960108 15:88653472-88653494 GTAGGGAACAGGGCTGAGTCTGG + Intronic
1131107503 15:89744965-89744987 ATGATGGTCAGGGCTGCGGCAGG + Intergenic
1131413355 15:92229867-92229889 GTGGTGGAGAGGGTGGAAGCTGG - Intergenic
1131441245 15:92461270-92461292 GTGGGGTAGAGGGCTGGGGCGGG - Intronic
1131593547 15:93773912-93773934 GTGGGAGGCAGGGCTGAGGCTGG - Intergenic
1132090337 15:98943090-98943112 CTGGTGGAAAGTGCAGAGGCTGG - Intronic
1132673952 16:1114062-1114084 GTGGTGAATGGGGGTGAGGCTGG - Intergenic
1132728342 16:1348495-1348517 GTGGGGGCCAGGGCCGGGGCTGG - Exonic
1132882296 16:2167801-2167823 GGGGTAGGCAGGGCTGGGGCAGG + Intronic
1133095670 16:3443517-3443539 ATGGCGGAGAGGGCTGAGGGCGG - Exonic
1133215011 16:4286866-4286888 GTGGTGGCAGAGGCTGAGGCGGG - Intergenic
1133269841 16:4605500-4605522 GGGGAGGGCAGGGCTGGGGCTGG - Intergenic
1133297826 16:4763744-4763766 GTGGTGGCCAGGAAAGAGGCTGG + Intronic
1133760867 16:8797544-8797566 GTCGGGGTCAGGGCTGGGGCGGG - Intronic
1134903740 16:17961493-17961515 GAGCTGGACAGAGCTGAAGCAGG + Intergenic
1135587168 16:23679867-23679889 GTTGTGGACAGTGTTAAGGCAGG + Intronic
1136335654 16:29608724-29608746 GAGGTGGGCTTGGCTGAGGCTGG - Intergenic
1137716026 16:50598781-50598803 GTGGTGGGCAGTGGTGTGGCAGG + Intronic
1137716053 16:50598909-50598931 GTGGTGGGCAGTGGTGGGGCAGG + Intronic
1138249045 16:55488533-55488555 ATGGTGAACAGGGCTAAGGGTGG - Exonic
1138263016 16:55639134-55639156 GCGGTGGGCAGGGGTGAAGCAGG - Intergenic
1138538150 16:57670940-57670962 GTGGTGCTGGGGGCTGAGGCGGG - Intronic
1139921440 16:70462990-70463012 GTGGTTGTCAGGGCGTAGGCGGG + Intronic
1141581602 16:85003229-85003251 GTGAGGGGCAGGACTGAGGCTGG + Intronic
1142175344 16:88642659-88642681 GTGGGGGACGTGGCTGACGCCGG + Intergenic
1142243494 16:88957826-88957848 GTGGTGGGCAGGGCAGAGGGAGG + Intronic
1142357058 16:89606200-89606222 GTGGTGGCCAAGGCAGGGGCAGG + Intergenic
1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG + Exonic
1143020896 17:3916782-3916804 GTGGTGGATGGGGCTGGGGATGG - Intergenic
1143446753 17:7014443-7014465 CCCGTGGAGAGGGCTGAGGCTGG + Exonic
1143759380 17:9090038-9090060 ATGGTGGGAAAGGCTGAGGCTGG + Intronic
1143974030 17:10816825-10816847 GTGGTGGACAGGGAAGAGTGGGG - Intergenic
1144783237 17:17818134-17818156 GAGGTGGGCAGGGCAGAGGGTGG + Intronic
1144786732 17:17836389-17836411 GTGATGGCCACGGCTGAAGCTGG - Intronic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1146377288 17:32303212-32303234 TTGGTGGACCGTGCTGGGGCAGG + Intronic
1146806128 17:35866525-35866547 GAGGTGGACAGGGGTTAGCCTGG + Intronic
1146834645 17:36100541-36100563 GTGAGGGAGAGTGCTGAGGCAGG + Intergenic
1147161972 17:38573617-38573639 ATGATGGACAGGAGTGAGGCTGG - Intronic
1147603084 17:41757815-41757837 GAGGTGGAAAGGGGTGAGGCAGG + Intronic
1147651394 17:42064034-42064056 TTGGGGGACAGGGCGGGGGCAGG - Intronic
1148090777 17:45021429-45021451 ATGGGGGGCAGGGCAGAGGCAGG - Intergenic
1148101132 17:45092358-45092380 GTGGTGGAAAGGGCTGCATCAGG - Intronic
1148854635 17:50572042-50572064 GTGGTGGACAGGGTCCAGGGAGG + Intronic
1149682834 17:58517738-58517760 GTGGGGGCCAGGGCGGAGCCGGG + Intronic
1150126553 17:62639230-62639252 GTTGGGGAGGGGGCTGAGGCAGG + Intronic
1150343659 17:64387962-64387984 GGGGTGGGCAGGGCGGCGGCTGG - Intronic
1150588921 17:66544110-66544132 GTGGTGGGGGGAGCTGAGGCAGG + Intronic
1151215772 17:72575486-72575508 GGGGTGGGCTGGGCTGAGGGTGG - Intergenic
1151451945 17:74203425-74203447 GGGGTGGACGGGGAAGAGGCGGG + Intergenic
1151889958 17:76946129-76946151 GGGGTGGGGAGGGATGAGGCTGG + Intronic
1151972682 17:77466955-77466977 GTGGGGGTCAGGGCTGGGTCTGG + Intronic
1151989808 17:77567001-77567023 GGGGTGGAGAGGGCAGAGACAGG + Intergenic
1152011565 17:77721980-77722002 GAGGTACACAGGGCTGATGCTGG - Intergenic
1152030713 17:77841086-77841108 GAGGTGGACAGGGTGGATGCTGG - Intergenic
1152274960 17:79350752-79350774 GTGGCAGACAGGGCTCAGGCAGG + Intronic
1152279099 17:79374965-79374987 GAGGTGGGTAGGGCTGGGGCAGG - Intronic
1152539759 17:80969058-80969080 GGGGAGGCCAGGGCTGAGCCAGG + Intergenic
1152595103 17:81234069-81234091 GTCGGGGGCAGGGCTGAGCCTGG + Intronic
1152639856 17:81444893-81444915 GTGCTGGCCAGGGCTCAGGAGGG + Intronic
1152656414 17:81521473-81521495 GGGATGGAGAGGGCTGAGGTGGG - Intronic
1152816786 17:82412548-82412570 AAGGTGGACAGGGCAGGGGCAGG + Intronic
1152906734 17:82974522-82974544 GTGAGGGACAGGAGTGAGGCAGG + Intronic
1153365287 18:4248860-4248882 GTGATGGACAAGGATGTGGCCGG - Intronic
1153704513 18:7732205-7732227 GTGATGGCCAGGGCTGGGGAAGG - Intronic
1153709387 18:7782600-7782622 GTGGTTGCCAGGGCTGGGGGAGG - Intronic
1153828349 18:8897788-8897810 ATGGAGGTCAGGGCTGAGGCTGG + Intergenic
1154501754 18:15000919-15000941 GGGGTGGGCAGGGCGGAGGGTGG + Intergenic
1155935328 18:31747265-31747287 GTGGTGGTCAGGGGTGAGAGTGG - Intergenic
1156276937 18:35592749-35592771 GTAGTGGATATGTCTGAGGCTGG + Intronic
1157165156 18:45352051-45352073 GTCGTGGACAGGGCTGTGGTGGG + Intronic
1157205126 18:45691554-45691576 GTGGGGGACAGGCCTAAGCCTGG - Intergenic
1157844854 18:50993770-50993792 GTGGTGTGCAGGGCTGGGGAGGG - Intronic
1158332768 18:56380866-56380888 GTGGTTGCCAGGGGTGAGGAGGG + Intergenic
1158478791 18:57803087-57803109 GCGGCGGCCAGGGCTGGGGCCGG - Exonic
1159836685 18:73345465-73345487 GTGGTGGACAGGGGTTAGAGGGG - Intergenic
1160026781 18:75224749-75224771 GTGGTGGGGAGGGGTGCGGCGGG + Intronic
1160110482 18:76024900-76024922 GTGGTGAAGAGGGCAGAGGGCGG - Intergenic
1160543933 18:79640518-79640540 GTGGTGGGCAAAGCTGGGGCAGG + Intergenic
1160898693 19:1415856-1415878 TCGGTGGGGAGGGCTGAGGCGGG - Intronic
1161241521 19:3225896-3225918 GGGGTGGACAGGGAGGAGGAGGG + Intronic
1161333799 19:3700347-3700369 GAGGCGGAGAGCGCTGAGGCGGG - Exonic
1161431232 19:4233493-4233515 GTGGAGGCCAGGGCTCAGGATGG - Intronic
1161459934 19:4390567-4390589 GTGGTGGCCAGGGCTGCAGCGGG - Intronic
1161591002 19:5129035-5129057 GTGGGGGCCAGGGCAGTGGCGGG + Intronic
1161592869 19:5136637-5136659 GTGGTGGGCACGGCTGGGGGTGG - Intronic
1162403807 19:10461678-10461700 ATGGTGGGCGGGGCTGGGGCGGG + Exonic
1162523016 19:11193119-11193141 GCGGTGGCCAGGCCTGGGGCTGG + Exonic
1162682923 19:12360479-12360501 GGGGTGGAGAGGCCTGAGGCCGG - Intronic
1162743866 19:12788616-12788638 GCCCTGGCCAGGGCTGAGGCTGG - Intronic
1163405096 19:17117091-17117113 GGGGAGGGCAGGGCTGTGGCAGG - Intronic
1163448573 19:17362117-17362139 TTGGAGCACAGGGCTGGGGCTGG - Intronic
1163478799 19:17542453-17542475 GTGGTGGACAGAGCTGGGGCAGG + Intronic
1163583981 19:18154186-18154208 GTGATGGACAGGGCTAGGGTCGG - Intronic
1163595334 19:18218085-18218107 CTGGTGGACAGGGTGGAGGCAGG + Intronic
1163772044 19:19197176-19197198 TGGATGGACAGGGCTGGGGCAGG - Exonic
1164206063 19:23059797-23059819 CTTGCAGACAGGGCTGAGGCAGG + Intergenic
1164211161 19:23098500-23098522 CCTGTGGACAGGGCTGAGGCAGG - Intronic
1164228087 19:23263729-23263751 TATGTGGACAGGGCTGAGGCAGG + Intergenic
1165154483 19:33778842-33778864 GTGGAGGACAGGGCTCAGCGTGG - Intergenic
1165386822 19:35514661-35514683 TTGCTGGGCAGGGGTGAGGCGGG - Intergenic
1165832455 19:38736399-38736421 GGCGTGGACAGGGGTTAGGCAGG - Intronic
1166226581 19:41399420-41399442 GAGGTGGGCAGGACTGGGGCAGG + Intronic
1166293618 19:41878495-41878517 GTGCTGGGCCTGGCTGAGGCTGG + Intronic
1166343112 19:42150417-42150439 GGGGTGGAGAGGGCTGGGGGAGG + Intronic
1166785630 19:45365015-45365037 CTGGAGGGCAGGGCTGAGGGAGG - Intronic
1167579220 19:50332136-50332158 GTGAGGGACTGGGCTGGGGCTGG + Intronic
1167611006 19:50507709-50507731 GGGGTGGCCAGAGCTGAGGTGGG + Intronic
1167705389 19:51078556-51078578 TTGGTGGAATGGGATGAGGCAGG - Intronic
1167798866 19:51727493-51727515 CTGGTGGACAGGGCTGGGCTGGG + Intergenic
1167838691 19:52095965-52095987 GGGGTGGGCGGGGCCGAGGCGGG + Intergenic
1168541446 19:57214453-57214475 GGGGTGGTGAGGGCTGAGGTGGG - Exonic
1168663114 19:58183073-58183095 GCGCTGGACAGGGGTCAGGCCGG - Exonic
1202703669 1_KI270713v1_random:5489-5511 TTGGTGGTGGGGGCTGAGGCAGG - Intergenic
925100342 2:1238869-1238891 GTGGTGGGCAGGGCAGGGGCAGG - Intronic
925157082 2:1656947-1656969 GGAGGGGACAGGTCTGAGGCAGG - Intronic
925158520 2:1664845-1664867 GTTCTGGACAGGGCTGAGCTGGG - Intronic
925169727 2:1743609-1743631 GAGGGGGAGAGGGCGGAGGCTGG + Intronic
925338553 2:3116430-3116452 GTGGTGCACTGGGCAGAGTCAGG + Intergenic
925863119 2:8199681-8199703 GTGGTGTGCAGGGTGGAGGCTGG + Intergenic
926054701 2:9767818-9767840 GGGGCTGACAGAGCTGAGGCAGG - Intergenic
926111203 2:10184949-10184971 CTGGTGCACAGGGCAGAGACGGG - Intronic
926125236 2:10267860-10267882 GTGGAGGGCAGGGCTGGGGAGGG - Intergenic
926126803 2:10277151-10277173 GTGGTGGGAGGGGATGAGGCAGG + Intergenic
926161731 2:10494533-10494555 GGGGAGGCCAGGGCTGGGGCGGG + Intergenic
928180477 2:29065121-29065143 ATGGAGGACAGGGGTGGGGCAGG - Intronic
928433524 2:31239281-31239303 TGGGTGGACAGGGCTGAAGGTGG - Intronic
929409522 2:41681946-41681968 GTGGTTGACAGGGGTTAGGAGGG - Intergenic
931169789 2:59790691-59790713 AAGAGGGACAGGGCTGAGGCGGG + Intergenic
933199643 2:79434568-79434590 GAGTTCCACAGGGCTGAGGCTGG + Intronic
933847182 2:86336105-86336127 GTGTTGGTCAGGCATGAGGCTGG + Intronic
933864587 2:86504591-86504613 GTGCTTTACAAGGCTGAGGCAGG - Exonic
934524578 2:95043748-95043770 CTGGGGGACAGGGCGGAGGAGGG - Intronic
934905496 2:98197824-98197846 GTGGATTTCAGGGCTGAGGCTGG - Intronic
934942987 2:98515822-98515844 GTGGTGGAGAGGGCACTGGCAGG - Intronic
935042666 2:99448084-99448106 GTGGTGGAAAAGGCTGGGCCTGG - Intronic
935667521 2:105525479-105525501 GAGGTGGGGAGGGCTGAGGGTGG + Intergenic
936950502 2:117973255-117973277 TAGGGGGACAGGGCTGGGGCAGG + Intronic
937832455 2:126438353-126438375 GTGGCGGAGGGGGCTGTGGCTGG - Intergenic
937981786 2:127620060-127620082 GCTGAGGACAGGGCTGTGGCTGG + Intronic
937985224 2:127635319-127635341 CTGGTACCCAGGGCTGAGGCTGG - Intronic
937990884 2:127661671-127661693 GTGCTGGAGAGGGCTGAGGAAGG - Intronic
938097645 2:128474065-128474087 CTGGAGGACGGGGCTGAGCCAGG - Intergenic
940829458 2:158452257-158452279 GTGGAGAACAGGGGTGAGGGGGG + Intronic
940900815 2:159124840-159124862 GGGGTGGGGAGAGCTGAGGCGGG - Intronic
942319656 2:174725308-174725330 GTGGAAGACAGGGGTGGGGCTGG + Intergenic
944506652 2:200419310-200419332 AAGGTGGAGAGGCCTGAGGCAGG + Exonic
945281112 2:208036421-208036443 GTGCAGGACAGGGCCTAGGCTGG - Intergenic
945969395 2:216221258-216221280 GAGGGGGACGTGGCTGAGGCAGG - Intergenic
946062852 2:216959668-216959690 GGGGTGGAGAGGACTGAGGCTGG + Intergenic
946149246 2:217753112-217753134 GTCTTGGACAGGGCTGGGGGTGG - Intronic
946365089 2:219244029-219244051 GTGGGGGTAGGGGCTGAGGCAGG + Intronic
948102014 2:235382795-235382817 ATGGTGAAGAGGTCTGAGGCGGG - Intergenic
948280868 2:236747147-236747169 GTAGTGGACAGGGCTGTAGAAGG + Intergenic
948296392 2:236863822-236863844 GTGGGGGACAGGGATGGGCCTGG + Intergenic
948363622 2:237439890-237439912 GTGGTGGAAGGTGCTGAGGAGGG - Intergenic
948659998 2:239501198-239501220 GTGGTGGTCAAGGGTGAGGGTGG + Intergenic
948675667 2:239595132-239595154 GAGGTGGCAACGGCTGAGGCTGG + Intergenic
948830731 2:240597159-240597181 GAGGTGGGCAGGGCTGATCCAGG + Intronic
1168848027 20:958684-958706 GTGGAGGGCAGGTCTGAGGGTGG + Exonic
1168893350 20:1308212-1308234 GTGGAGGACTGGGCTGTGGTTGG + Exonic
1170061689 20:12265798-12265820 ATGCTTGCCAGGGCTGAGGCAGG + Intergenic
1170534873 20:17330740-17330762 CAGGTGGCCAGGTCTGAGGCTGG + Intronic
1170557477 20:17526334-17526356 GTGGTTGTCAGGGCTGGGGATGG - Intronic
1170662883 20:18360092-18360114 CTGGAGGACAAGCCTGAGGCTGG - Intergenic
1170696553 20:18664572-18664594 GTGGTGGCCAGGGGTGATGGGGG + Intronic
1171421302 20:25019628-25019650 GTGGTGGCAAAGGCTGAGGTGGG - Intronic
1171424222 20:25039544-25039566 ATGGAGGACAGGGCCGAGGGTGG + Intronic
1171433855 20:25104302-25104324 GTGGTGGAAAGGACAGAGGAGGG - Intergenic
1171474495 20:25397686-25397708 GTGGTGGTGGAGGCTGAGGCAGG + Intergenic
1172111110 20:32545564-32545586 GTGGTGGCCAGGGCTGTGGGCGG - Intronic
1172186311 20:33033109-33033131 GTGGTGGTTAGGGCAGAGGGTGG + Intronic
1172240781 20:33411301-33411323 GGGGTGGAAAGGGAGGAGGCTGG - Intronic
1172664736 20:36591213-36591235 CTGCTGACCAGGGCTGAGGCTGG + Exonic
1173011901 20:39190606-39190628 GGACTGGACAGGGATGAGGCTGG + Intergenic
1173114676 20:40229565-40229587 GTGGAGGCAAGGGCTGAGGCTGG + Intergenic
1173499020 20:43539065-43539087 GTGGTTGGTAGGGCTGAGGATGG + Intronic
1173539888 20:43843370-43843392 GAGGCGGACAGGGCAGGGGCAGG - Intergenic
1174369893 20:50079482-50079504 GTGGTGGCAGGTGCTGAGGCAGG - Intergenic
1174478703 20:50815734-50815756 GTGGTGGAGATGGCTCATGCTGG + Intronic
1174483301 20:50845764-50845786 GGAGTGGAGAGGGCTGAGGTGGG + Intronic
1174567711 20:51478766-51478788 GTGGAGGAGAAGGCAGAGGCTGG - Intronic
1174870045 20:54173704-54173726 GTGATGGAGCGGGGTGAGGCGGG + Exonic
1174948199 20:55012338-55012360 GTGAAGGAAAGGGTTGAGGCAGG - Intergenic
1175366053 20:58456995-58457017 GGGGTGGTCAGGGGTGAGGTGGG + Intergenic
1175441745 20:58997048-58997070 TCGGTGGAGGGGGCTGAGGCGGG + Intronic
1175698641 20:61121514-61121536 GGGGTTGAAAGGGCTCAGGCGGG + Intergenic
1175831775 20:61968584-61968606 GAGGTGGAAAAGGCTGGGGCTGG - Intronic
1176102328 20:63370216-63370238 GGGGAGGGCAGGGCTGAGGAGGG - Intronic
1176136226 20:63523175-63523197 CCGGTGGTCAGTGCTGAGGCTGG + Intergenic
1176866278 21:14056639-14056661 GTCTAGGACAAGGCTGAGGCAGG + Intergenic
1177861705 21:26462247-26462269 GTGGTGGCAAGGGATGAGGAGGG + Intergenic
1178190362 21:30273084-30273106 GTGGTGGGGAGGCCTGGGGCAGG + Intergenic
1178680687 21:34670124-34670146 GTGGGGGACAGCGTAGAGGCGGG + Exonic
1179447851 21:41445700-41445722 AGGGTGGACAGGGCTGAGGGAGG + Intronic
1179906569 21:44426031-44426053 GTGGTGGAGGGGCCTGAGGGGGG + Intronic
1179912900 21:44459746-44459768 GAGGTGCACAGGGCAGGGGCAGG + Exonic
1180090961 21:45533663-45533685 CTGGTGGTCAGGCCTGAGTCGGG - Intronic
1180109942 21:45643086-45643108 GTGGTGGGCAGGGCCGTGGATGG - Intergenic
1180185739 21:46138406-46138428 GTGGTTGGCTGGGCTGAGCCAGG - Intronic
1180235913 21:46459255-46459277 GCGGGGGACCGGGCTGAGGGCGG - Intronic
1181031435 22:20150332-20150354 GTGGTGGGTGGGGCTGGGGCTGG + Intronic
1181031458 22:20150381-20150403 GTGGTGGGTGGGGCTGGGGCTGG + Intronic
1181084005 22:20430944-20430966 GATGGGGACAGGGGTGAGGCGGG - Intronic
1181100026 22:20532761-20532783 ATGTTGGACAGGACTGTGGCAGG + Intronic
1182461248 22:30485528-30485550 CTGGTGGACAGGGGTGCGGCTGG + Intergenic
1182541397 22:31044639-31044661 GTGGGGGAGGGGGCGGAGGCTGG - Intergenic
1182712977 22:32334238-32334260 GAGGTGGAGAGGGCAGAGGTGGG - Intergenic
1182772452 22:32805064-32805086 GTGGCTGGCAGGGCTGAGGGGGG + Intronic
1183062132 22:35342675-35342697 CTGGTGTAGAGGGATGAGGCAGG - Intronic
1183335266 22:37242700-37242722 GAAGTGAACAGGGCTGGGGCAGG + Intronic
1183343366 22:37294188-37294210 GAGGTGGGCAGGGTGGAGGCGGG + Intronic
1183343384 22:37294231-37294253 GAGGTGGGCAGGGTGGAGGCGGG + Intronic
1183598611 22:38827014-38827036 GGGGTAGACAGGCCAGAGGCAGG + Intronic
1183686962 22:39366702-39366724 GTGAGGGACAGGCCTGGGGCTGG - Intronic
1184036377 22:41920109-41920131 GTGGTGGCCGGGGCTGACGGCGG + Intergenic
1184391780 22:44207247-44207269 TTGGTGGGGAGGGCTGGGGCTGG + Exonic
1184493553 22:44824374-44824396 GTGGTGCACTGGACTGAGCCTGG - Intronic
1184529416 22:45045075-45045097 GGCGTCGGCAGGGCTGAGGCAGG + Intergenic
1185315210 22:50176006-50176028 CTGGGAGACAAGGCTGAGGCTGG + Intronic
949930508 3:9074662-9074684 ATGGTGGAGAGAGCTGAGACTGG - Intronic
950259290 3:11532356-11532378 GAGGAGGACAGAGCTGAGTCTGG + Intronic
950534088 3:13569410-13569432 GTGGTGGGCAGGGAGGTGGCGGG + Intronic
950835812 3:15918032-15918054 ATGATGGAAATGGCTGAGGCTGG + Intergenic
952856074 3:37771822-37771844 GTGGTGGAAATGGGTCAGGCTGG + Intronic
953546299 3:43865981-43866003 GTGGTAAACAGGACTTAGGCCGG + Intergenic
953752995 3:45623711-45623733 GTGAGGGAGAGGGCAGAGGCAGG + Intronic
954176152 3:48847439-48847461 GCGGCGGGCAGGACTGAGGCTGG + Exonic
954325071 3:49859113-49859135 GTGGTGGGCAGGCCAGTGGCAGG - Exonic
954374144 3:50185366-50185388 GTGGGGGAAGGGGCTGAGGCTGG + Intronic
958512923 3:95072189-95072211 GTGGTTGACAGGGCTGAGAGGGG + Intergenic
958514295 3:95092527-95092549 GAGGTGGACTTGGCTGAGGATGG + Intergenic
959325335 3:104929838-104929860 GTGGGGGGCGGGGCTGAGGCAGG - Intergenic
959933534 3:112007408-112007430 GTGGTTGCCAGGGTTGAGGGTGG - Intronic
961017379 3:123478684-123478706 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017387 3:123478716-123478738 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017395 3:123478748-123478770 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017403 3:123478780-123478802 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017411 3:123478812-123478834 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017419 3:123478844-123478866 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017427 3:123478876-123478898 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017435 3:123478908-123478930 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017443 3:123478940-123478962 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017451 3:123478972-123478994 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017459 3:123479004-123479026 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017467 3:123479036-123479058 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017475 3:123479068-123479090 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961017483 3:123479100-123479122 CAGGTGGACAGTGCTGGGGCAGG + Intergenic
961326710 3:126113320-126113342 GTGGGTGACAGGGCAGAGGGTGG + Intronic
961453277 3:127012161-127012183 GAGGTGGCCAGGGCAGGGGCTGG + Intronic
961722074 3:128903497-128903519 GTGGAGGACATGGCTATGGCGGG + Intronic
961820534 3:129573530-129573552 GAGGAGGACAGAGCAGAGGCTGG + Intronic
963732576 3:148987335-148987357 GTGGTGGAGGGTGCTGAGGCAGG + Intergenic
963795105 3:149624041-149624063 GTGGTGGGGAGGGATGTGGCCGG - Intronic
964368668 3:155976082-155976104 GAGGTGGAGGAGGCTGAGGCAGG + Intergenic
964782153 3:160352125-160352147 GTGGTGGCGGGTGCTGAGGCAGG - Intronic
965686392 3:171307311-171307333 CTGGTTGACATGGATGAGGCTGG - Intronic
966871214 3:184291534-184291556 CTGGTGAATGGGGCTGAGGCTGG + Intronic
967218366 3:187228915-187228937 GGGGTGGACAGCTCTGGGGCAGG - Intronic
967371867 3:188755696-188755718 CTGGTGGCAAGGGCTGAGGGAGG + Intronic
968439165 4:612856-612878 CTGGTGTCCAGGGTTGAGGCGGG + Intergenic
968578345 4:1378186-1378208 GTGGGAGACAGGGCTGATGGGGG + Intronic
968613501 4:1567440-1567462 GCGGGGGACAGGGCTGCTGCAGG - Intergenic
968699546 4:2048036-2048058 GAGGTGGAGAGGGCAGGGGCCGG + Intergenic
968957810 4:3728089-3728111 CTGGTAGCCAGTGCTGAGGCAGG - Intergenic
969268871 4:6085377-6085399 GTGGGGGACCAGCCTGAGGCTGG + Intronic
969496824 4:7530990-7531012 GTGGTGGCCAGGGTGGAGGATGG + Intronic
969692370 4:8710680-8710702 GGGGTGGCAAGGGGTGAGGCAGG - Intergenic
969694931 4:8729159-8729181 GGGATGGAAAGGGCTGGGGCAGG + Intergenic
971267835 4:25110700-25110722 TGGGTGGAAAGGGCAGAGGCGGG - Intergenic
971358140 4:25913377-25913399 GTGGTGCAGAGGGCGGAGGATGG + Intronic
972436536 4:39040756-39040778 GTGGTGAAGAGAGCTGAGGCTGG + Intergenic
973329401 4:48897067-48897089 GTGGTGGACACAGCTTAGGGTGG + Intronic
977961205 4:103087463-103087485 GAGGAGGAGAGGGCTGAGGCAGG + Intronic
979494625 4:121369821-121369843 GGGGTGGACAGGGCTGATGCAGG + Intronic
979943571 4:126794977-126794999 GTGGTTGCCAGGGCGGAGGGAGG + Intergenic
983196008 4:164807258-164807280 GTGGGGGGCAGTGCTGAGGTGGG + Intergenic
985423878 4:189810535-189810557 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423898 4:189810612-189810634 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423909 4:189810645-189810667 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423920 4:189810678-189810700 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423939 4:189810744-189810766 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423950 4:189810777-189810799 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423970 4:189810843-189810865 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985423981 4:189810876-189810898 GCGGTGTCCCGGGCTGAGGCCGG + Intergenic
985424081 4:189811732-189811754 GTCAAGGACAGGGCTGTGGCAGG - Intergenic
985490438 5:175657-175679 GAGGGGGTCAGGGCTCAGGCGGG - Intronic
985490455 5:175716-175738 GAGGGGGTCAGGGCTCAGGCGGG - Intronic
985490472 5:175775-175797 GAGGGGGTCAGGGCTCAGGCGGG - Intronic
985490489 5:175834-175856 GAGGGGGTCAGGGCTCAGGCGGG - Intronic
985490538 5:176009-176031 GAGGGGGTCAGGGCTCAGGCGGG - Intronic
985618422 5:938418-938440 TTTGGGGTCAGGGCTGAGGCTGG + Intergenic
985621644 5:959271-959293 GTGGGGGGCAGGGCTGGGGGTGG - Intergenic
985627857 5:999328-999350 GGGGTGCCCATGGCTGAGGCAGG - Intergenic
985654232 5:1121722-1121744 GTGCTGGGCATGGCTGGGGCGGG - Intergenic
985663902 5:1172020-1172042 TTGCTGGACAGTGCTGGGGCAGG - Intergenic
985677177 5:1238183-1238205 CTGGTGGTCAGGGGTGAGGTTGG + Intronic
985822275 5:2168482-2168504 GTGGTGGACAAGGAGCAGGCAGG + Intergenic
985921774 5:2983214-2983236 GTGCTGGCCAGGGCAGAGGAGGG + Intergenic
985936391 5:3101157-3101179 GTGGAGGACAGAGCCGAGGCTGG - Intergenic
986125074 5:4876936-4876958 GTGCTGGACAGTGATGCGGCGGG - Intergenic
986322261 5:6641538-6641560 GTGGTGGACAGGGGAGAGGAGGG - Intronic
986667279 5:10114636-10114658 GTGGTTGACAGGGCTGAGCATGG + Intergenic
989193893 5:38697007-38697029 GTGGTTGACAGGGCTGAGCTTGG + Intergenic
992376933 5:76197499-76197521 GCTGGGGACAGGGCTGAGGGGGG + Intronic
993268742 5:85764944-85764966 GTAGTGGCCAGGGGGGAGGCAGG - Intergenic
998063335 5:139136348-139136370 GAGGTAGACAGGGCTAAGGCAGG + Intronic
998404034 5:141863536-141863558 GTGGAGGACGAGGATGAGGCCGG - Exonic
998423904 5:142011631-142011653 CTGGTGGACAGGGCTGACTTAGG + Intronic
999124162 5:149234436-149234458 GTAGTGGACAGGGCCAGGGCTGG - Intronic
1000068382 5:157716789-157716811 GTCCTTGACAAGGCTGAGGCAGG - Intergenic
1000305392 5:159989894-159989916 GTGGTTGTCAGGGCTGATGAAGG - Intergenic
1001315284 5:170637352-170637374 GTGGGGGCCAGGGCAGAAGCAGG - Intronic
1001598655 5:172914849-172914871 CAGGTAGAAAGGGCTGAGGCAGG - Intronic
1002018810 5:176348289-176348311 GGGGTGGACTGGGCTGATGCAGG + Exonic
1002042928 5:176527810-176527832 TTGGAGGACAGGGATCAGGCTGG + Exonic
1002964407 6:1948623-1948645 GTGTTGTACAGTGCTCAGGCTGG - Intronic
1004314274 6:14572419-14572441 GGGGTGGGCTGGGGTGAGGCAGG - Intergenic
1005411148 6:25548257-25548279 GTGGTGGAAGGGGTTGAGGTAGG + Intronic
1005423658 6:25678747-25678769 GTGGTGGGCAGGGCCCAGGCTGG + Intronic
1005692680 6:28322410-28322432 GTGGTGTACAGGGGTGGGGTGGG - Intergenic
1006152256 6:31995825-31995847 GAGGGGGTCAGGGCTGGGGCAGG + Intronic
1006158559 6:32028563-32028585 GAGGGGGTCAGGGCTGGGGCAGG + Intronic
1006914007 6:37583118-37583140 GTGGTGGAGAAGGCTGTGGGAGG - Intergenic
1007016612 6:38474225-38474247 GTTCTGGAAAGAGCTGAGGCTGG + Intronic
1007756461 6:44102759-44102781 GTGGAGGCCTGGGCTGAGGCAGG - Intergenic
1008506599 6:52236943-52236965 GTGGATGACAGGGGTGACGCAGG + Exonic
1008639383 6:53445953-53445975 GTGGAGGACATGGCTGTGCCCGG + Intergenic
1009561847 6:65256414-65256436 GTGGTGGGGAGGGGGGAGGCGGG - Intronic
1010180144 6:73076909-73076931 GTGGTGTTGAGGGCTGAGGCAGG + Intronic
1011811408 6:91136217-91136239 GCCGGGGACAGGGCTGAGGTGGG + Intergenic
1013164466 6:107577342-107577364 GTTGTGGACAGAGCAGAGGCTGG + Intronic
1013288169 6:108698266-108698288 GAGGGGGACAGGGCTGACCCTGG - Intergenic
1015430729 6:133128010-133128032 TGGGTGGAGAGGGCTGAGGAAGG + Intergenic
1015667930 6:135652477-135652499 GAGGGGGGCAGAGCTGAGGCAGG - Intergenic
1016079633 6:139839996-139840018 GTGATGGACAGCTCAGAGGCTGG - Intergenic
1016870081 6:148808030-148808052 GTGGGAGGCAGGGCTGGGGCTGG + Intronic
1017638900 6:156471470-156471492 GGGGAGGAGAGGGCTCAGGCTGG - Intergenic
1017879184 6:158547960-158547982 GGGGTGGAAGGGGCAGAGGCTGG - Intronic
1017929736 6:158941386-158941408 GCGGAGGACAGGGCTGAGCAAGG + Intergenic
1017959964 6:159213111-159213133 TTTGGGGACAGGGCTGAGGCTGG - Intronic
1018241898 6:161785085-161785107 GTGGTGGCCAGGGCTAGGACAGG + Intronic
1018849772 6:167578526-167578548 TAGGTGGACAGGGCAGAGGAAGG + Intergenic
1018901628 6:168054559-168054581 GTGGGGGGCAGGGCTGGGGGTGG - Intergenic
1019378968 7:711737-711759 GGGGTGGAGGGGGCTCAGGCAGG + Intronic
1019381830 7:727811-727833 GGGGTGGAGGGGGCTCAGGCAGG - Intronic
1019557248 7:1638707-1638729 GTGATGGGCAGGGCTGGGGAGGG + Intergenic
1019644597 7:2122237-2122259 GAGGTGGACAGGTCTGACGCGGG - Intronic
1021514277 7:21465749-21465771 CTACTGGAGAGGGCTGAGGCGGG + Intronic
1021952345 7:25787449-25787471 TTGGGGGACAGGGCTGAGGTGGG - Intergenic
1022248918 7:28587540-28587562 GAGGTGGACTGGGCTGGGGGTGG + Intronic
1022302346 7:29113381-29113403 GTGGTGGACAGTGGGGAGACTGG + Intronic
1022506597 7:30911637-30911659 GGGCTGGGCAGGGCTGAGGGCGG + Intergenic
1022972560 7:35530936-35530958 GATGTGGAGAGGGCAGAGGCTGG - Intergenic
1023042390 7:36183036-36183058 CAGGCGGACAGGGCTCAGGCAGG + Intronic
1023229693 7:38013507-38013529 GTGGTGGGGACCGCTGAGGCAGG - Intronic
1023746745 7:43329187-43329209 GGGGTGGGAAGGGGTGAGGCTGG + Intronic
1024019154 7:45349314-45349336 GTGGTGGCAATGGCTGAGGTGGG + Intergenic
1024191812 7:47019779-47019801 GCTGTGGCCAGGGCTGGGGCTGG - Intergenic
1024768668 7:52691625-52691647 GTGGTGGGAAGGGCAGAGGATGG + Intergenic
1025301174 7:57820712-57820734 AGGGAGGACAGGGCAGAGGCCGG - Intergenic
1025999440 7:66549671-66549693 GTGACTGACAGGGGTGAGGCAGG + Intergenic
1026738907 7:72966191-72966213 GGAGTGGACAGGACTGAGGTCGG - Intronic
1027056468 7:75053106-75053128 GTGGTGCACGGGGCTGGGGGTGG + Intronic
1027056485 7:75053151-75053173 GTGGTGGACAGGGCTGGGGGTGG + Intronic
1027056517 7:75053241-75053263 GTGGTGGACAGGTCTGGGGGTGG + Intronic
1027104826 7:75398878-75398900 GGAGTGGACAGGACTGAGGTCGG + Intronic
1027215340 7:76179899-76179921 GTGGGGGCCAGGGCGCAGGCAGG - Intergenic
1028128889 7:87147238-87147260 GTGGTGGGCTGGAGTGAGGCAGG - Intergenic
1029192965 7:98784880-98784902 GGGGTGGCCAGGGATGAGGAGGG + Intergenic
1029699937 7:102239654-102239676 ATGGCGCACAGGGGTGAGGCTGG + Intronic
1031025139 7:116672031-116672053 GTCGTGGGCGGGGCAGAGGCGGG + Intergenic
1031738891 7:125402624-125402646 GTGGTGGAGGGCGCTGAGGCAGG - Intergenic
1031890915 7:127292695-127292717 GTTGTGGACATGGCTGAGAGAGG - Intergenic
1032442483 7:131952607-131952629 GTGGGTGACAGGGCTCAGGAGGG + Intergenic
1032457377 7:132083630-132083652 CAGGTGGCCAGGGCTGAGCCTGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034119280 7:148611984-148612006 GTGGTGGACAGGGAGGGAGCAGG - Intronic
1034435166 7:151059866-151059888 GTGGAGGAAAGGGCGGAGACTGG + Intronic
1034464373 7:151217895-151217917 TGGTTGGACAGTGCTGAGGCTGG - Intronic
1035061281 7:156071331-156071353 GGGGTGGGCAGGGCTGAGTCGGG + Intergenic
1035271519 7:157722677-157722699 GGGGGGGACAGGGGTGAGGAGGG + Intronic
1035911896 8:3576431-3576453 GTGGTACACAGTGCTGAGGAGGG - Intronic
1037489346 8:19382940-19382962 CTACTTGACAGGGCTGAGGCAGG - Intronic
1037584712 8:20268530-20268552 TTGGGGGCCAGGGCTGGGGCAGG + Intronic
1038507283 8:28095451-28095473 GTGGTGGTCATGGCAGAGGAAGG - Intronic
1038781238 8:30569780-30569802 GGGGTGCACAGGGATGAGTCTGG + Intronic
1039478250 8:37852906-37852928 GAGGAGCCCAGGGCTGAGGCTGG - Intergenic
1040644704 8:49384563-49384585 ATGTTGGACAGGTATGAGGCAGG - Intergenic
1041730568 8:61058179-61058201 TTGGCAGGCAGGGCTGAGGCTGG + Intronic
1042463158 8:69094389-69094411 GTGGTGGAGGGGGGTGAGGTGGG + Intergenic
1043404025 8:79912376-79912398 GTGGTGTACAGATCTGAGGGTGG + Intergenic
1044591307 8:93916825-93916847 GAGGCGGAGAGGGCTGCGGCCGG - Intronic
1046102979 8:109635777-109635799 GTGTTGGACAGGGAGGGGGCAGG - Intronic
1049218472 8:141418195-141418217 GCCGCGGTCAGGGCTGAGGCGGG - Intronic
1049334626 8:142076639-142076661 GTGAGGGTCAGGGCTGTGGCAGG - Intergenic
1049444976 8:142625794-142625816 GTGGTGGAAGGGGCTGCGGTGGG - Intergenic
1049618701 8:143588253-143588275 GTGGTGGGGCGGGCTGAGTCAGG - Intronic
1049752068 8:144289698-144289720 GGTGTGGAGAGGGCTCAGGCAGG - Intronic
1049800427 8:144515121-144515143 GTGGCTGCCAGGGCTGAGGCTGG - Intronic
1050055926 9:1654332-1654354 GTGGTGGAAAGGGTTGAGAGAGG - Intergenic
1051620572 9:19045974-19045996 CTGCTGGAGAAGGCTGAGGCAGG + Intronic
1052399125 9:27978504-27978526 ATGGTGGAAAGGGGTGAGGGAGG - Intronic
1052640890 9:31165036-31165058 CTTGGGGCCAGGGCTGAGGCAGG + Intergenic
1052642205 9:31182642-31182664 GTGGTGGTCGGGGCTGGGGTAGG + Intergenic
1053140668 9:35680667-35680689 GTGGTGGAGTGCACTGAGGCAGG + Intronic
1053784577 9:41645063-41645085 ATGGAGGACAGAGCAGAGGCCGG - Intergenic
1055128640 9:72749566-72749588 GTGCTGGGCTGGGCTGAGGTAGG + Intronic
1056587560 9:87938472-87938494 GTGGTGGAGTGGGGGGAGGCGGG - Intergenic
1056719496 9:89059984-89060006 GTGGTGGACATGGTGGAGGATGG + Intronic
1057196942 9:93120712-93120734 GAGGAGGAAAGGGCAGAGGCTGG + Intergenic
1057200313 9:93136206-93136228 GTGGGTGTCAGGGCTCAGGCAGG + Intergenic
1057439047 9:95068982-95069004 GGAGTGAACAGGGCTGTGGCAGG - Intronic
1057440829 9:95082038-95082060 GTGGAGGAAAGGGCGCAGGCGGG + Intronic
1057771236 9:97969820-97969842 GAGGTGGAAAGGGCTAAGGCAGG - Intergenic
1059846073 9:118278357-118278379 GAAGTGGACAGGACTGAGTCAGG + Intergenic
1060056479 9:120418320-120418342 GTGGTGGACAGGGCGAAGGGTGG + Intronic
1060080737 9:120641992-120642014 GTGGTGGAAAGTGGAGAGGCAGG - Intronic
1060918874 9:127406695-127406717 GTGGTGGAAATGGGTGAGACAGG - Intronic
1060946770 9:127574357-127574379 GTGGTGGGCAGGGGAGGGGCGGG - Intronic
1061002173 9:127908589-127908611 GTGGGGAACAGGGCTGGGGTGGG + Intronic
1061191001 9:129082639-129082661 GTGATGGACCTGGCTGAGCCTGG + Intronic
1061203198 9:129148760-129148782 GTGATGGTCTGGGCAGAGGCTGG + Exonic
1061218350 9:129234988-129235010 AGGGTGGGCAGGGATGAGGCTGG - Intergenic
1061274202 9:129560146-129560168 TGGGGGGGCAGGGCTGAGGCAGG - Intergenic
1061390773 9:130316007-130316029 GTAGCAGACAGGGCTCAGGCAGG + Intronic
1061499502 9:130993849-130993871 GTGGTGAGCAAAGCTGAGGCTGG - Intergenic
1061794952 9:133081141-133081163 GTGGGGGAGAGGGCTGGGGCAGG - Intronic
1061949230 9:133926909-133926931 GTTGTGGCCAGGGCTGGTGCTGG - Intronic
1061963592 9:134000394-134000416 GTGGTTGCCATGGCTGAGGATGG - Intergenic
1062116727 9:134813637-134813659 GGGATGGCCAGGGCCGAGGCAGG - Intronic
1062279972 9:135747464-135747486 GGGGCAGGCAGGGCTGAGGCGGG - Intronic
1062498735 9:136843429-136843451 GGGGTGGGCAGGGCGGAGGGTGG - Intronic
1062682033 9:137787411-137787433 GTGGGAGGCAGGGCTGAGCCTGG - Intronic
1062694749 9:137867717-137867739 GTGGAGCACAGCGCTGTGGCTGG - Intronic
1203790832 EBV:150811-150833 CAGGTGGACAGGGCCGAGGAGGG - Intergenic
1185506381 X:634582-634604 GGAGGGCACAGGGCTGAGGCCGG - Intronic
1185510516 X:660697-660719 GGGGTGGGCAGGGCTGGGGTTGG + Intergenic
1186396983 X:9219632-9219654 GTGGTGGGCTGTGGTGAGGCAGG - Intergenic
1186420290 X:9420186-9420208 GTGGGGAACTGGGCTCAGGCAGG + Intergenic
1188365686 X:29312311-29312333 GTGGTGGTGTGGGCTGAGGCAGG + Intronic
1189288374 X:39867908-39867930 GAGGTGGACGGGGCTGGCGCTGG - Intergenic
1189893954 X:45633723-45633745 CTGGTGGACATGGTGGAGGCAGG + Intergenic
1190011822 X:46791634-46791656 GTGGGGGGAGGGGCTGAGGCAGG + Intergenic
1190054343 X:47173259-47173281 GTGGGGGAGAAGGCAGAGGCAGG - Intronic
1190117828 X:47637601-47637623 GTGATTGACTGGGCTGATGCTGG - Intronic
1190493669 X:51006825-51006847 GTGGTAGCCAGGGCTCAGGAAGG + Intergenic
1190511101 X:51175274-51175296 GTGGTAGCCAGGGCTCAGGAAGG - Intergenic
1190935282 X:54994104-54994126 CAGGTGGACAGGGCTGGGACAGG + Intronic
1191884311 X:65873652-65873674 GTGGGAGATAGGGCTGAGGGAGG - Intergenic
1193977997 X:88147439-88147461 GTGGTCATCAGGCCTGAGGCAGG - Intergenic
1194524177 X:94957317-94957339 GGGGTGGAGCGGGCTGAGGTAGG - Intergenic
1195429101 X:104768303-104768325 GTGGGGGAAAGGGTTGAGGCAGG - Intronic
1197289105 X:124632935-124632957 GTGGTGGAGATGGCTGAGAGAGG - Intronic
1197728896 X:129794043-129794065 GTGGAGGGCGGGGCTCAGGCAGG - Exonic
1199856061 X:151759598-151759620 GGGGTGGGCAGAGCTGGGGCTGG + Intergenic
1200210786 X:154345815-154345837 GTGGGGGGCAGGCCCGAGGCAGG - Intergenic
1200212746 X:154354118-154354140 GCGGTGGAGTGGGCAGAGGCAGG + Intronic
1200220066 X:154386277-154386299 GTGGGGGGCAGGCCCGAGGCAGG + Intergenic
1200859151 Y:7971756-7971778 ATGGTGAGCAGGGCTCAGGCAGG + Intergenic
1200906811 Y:8492185-8492207 CTGGTGGTCAGGGCCAAGGCAGG - Intergenic
1201295638 Y:12460889-12460911 GTGGTGGACAGGGAACAGGAGGG - Intergenic
1201329635 Y:12803834-12803856 TGGGTGGACAGGGTTGGGGCAGG + Intronic
1201695404 Y:16818634-16818656 GTGTTGGACAGAGAAGAGGCAGG - Intergenic
1202368637 Y:24183068-24183090 GGGGTGGCCGGGGCTGGGGCGGG - Intergenic
1202502148 Y:25487049-25487071 GGGGTGGCCGGGGCTGGGGCGGG + Intergenic