ID: 913530174

View in Genome Browser
Species Human (GRCh38)
Location 1:119728377-119728399
Sequence CTGGAAGGACAGATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 12, 3: 52, 4: 445}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913530174 Original CRISPR CTGGAAGGACAGATGGACAA TGG (reversed) Intronic
900485659 1:2921440-2921462 CTGGATGGACAGATGGACACAGG - Intergenic
900485667 1:2921482-2921504 CTGGATGGACAGATGGACAGAGG - Intergenic
900485675 1:2921524-2921546 CTGGATGGACAGACGGACACAGG - Intergenic
900485683 1:2921566-2921588 CTGGATGGACAGATGGACACAGG - Intergenic
900485691 1:2921608-2921630 CTGGATGGACAGATGGACACAGG - Intergenic
900485699 1:2921650-2921672 CTGGATGGACAGATGGACACAGG - Intergenic
900485707 1:2921692-2921714 CTGGATGGACAGATGGACGGAGG - Intergenic
900485716 1:2921734-2921756 CTGGATGGACAGATGGACGGAGG - Intergenic
900485725 1:2921776-2921798 CTGGATGGACAGATGGACGGAGG - Intergenic
900485735 1:2921818-2921840 CTGGATGGACAGATGGACGGAGG - Intergenic
900485744 1:2921860-2921882 CTGGATGGACAGATGGACGGAGG - Intergenic
900485753 1:2921902-2921924 CTGGATGGACAGATGGACAGAGG - Intergenic
900485761 1:2921944-2921966 CTGGATGGACAGATGGACAGAGG - Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
901098811 1:6703347-6703369 CTGGAAGAGCTGATGGACCATGG - Intergenic
901261895 1:7877534-7877556 CCAGAAGAAGAGATGGACAAAGG + Intergenic
901699871 1:11039580-11039602 CTGGAAGGATGGATGGATGATGG + Intronic
901945807 1:12702622-12702644 GAGGGAGGACAGAGGGACAAAGG - Intergenic
902155472 1:14482104-14482126 CTGCATGGATAGATGGCCAAAGG + Intergenic
902603883 1:17558106-17558128 ATGGATGGATGGATGGACAATGG - Intronic
903341661 1:22658744-22658766 ATGGATGGATAGATGGACAGAGG + Intronic
903341681 1:22658819-22658841 ATGGATGGACAGATGGACAGAGG + Intronic
903768791 1:25751136-25751158 ATGGAAGGAAAGATGAACGAAGG - Intronic
904096746 1:27984860-27984882 ATGGAAGGAGAGTTGGAGAAGGG - Intronic
904594416 1:31634116-31634138 CAGTAAGGACAGAGGGAAAAAGG + Intronic
904871396 1:33621188-33621210 CTAGAAGGAGAGATGGACATGGG - Intronic
905307406 1:37029217-37029239 CTGGGAAGACAGATGCACTAAGG - Intronic
905398448 1:37683788-37683810 CTGGTAGGAAACATGAACAAAGG + Intronic
905406265 1:37734631-37734653 CTGCAACCACAGATTGACAATGG + Intronic
905891252 1:41519845-41519867 ATGGAAGGATAGATGGAGAATGG + Intronic
906095024 1:43217062-43217084 CTTCCAGGACAAATGGACAAGGG + Intronic
907814034 1:57900634-57900656 CTGGTTGGCCACATGGACAAAGG - Intronic
907951020 1:59184306-59184328 CTGCAAGGAAAGATGAAAAATGG - Intergenic
909137597 1:71820958-71820980 CTGGCATGACAGATGCAAAAAGG - Intronic
910371159 1:86516502-86516524 CAGGTTGGAAAGATGGACAAAGG - Intergenic
911042303 1:93600411-93600433 CTGGCAGGGGAGATGGGCAAGGG + Intronic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
912202744 1:107476844-107476866 CTGGAATGATGGATGCACAAAGG - Intronic
912402392 1:109405911-109405933 CTGGAAGTAGGGATGGAGAAGGG + Intronic
912801494 1:112722554-112722576 CTGGAAGGAGAGGTGAGCAAAGG - Intronic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
915009167 1:152668681-152668703 CAGAAAGGACAGAGGGACATGGG - Intergenic
915865949 1:159499568-159499590 TAGGAAGAACAGATGGAGAAAGG - Intergenic
916306767 1:163344403-163344425 CTGGAAGTACAGGTGGAAGAGGG + Intronic
916742033 1:167654578-167654600 CTGGAAGGAGAGATTGACAGGGG + Intronic
916800524 1:168211606-168211628 CTGCAAGAACAGATGGGCAATGG + Intergenic
916838927 1:168579415-168579437 CTGAAAGGAAAGATGGCCAAAGG - Intronic
917146692 1:171899912-171899934 CTTGAAGGACAAATGGGCAAGGG + Intronic
917209472 1:172616686-172616708 CTGGATGGACAGGTGAACAGTGG + Intergenic
918259207 1:182779546-182779568 CAGGTTGGACAGATGGACAGTGG - Intergenic
919151844 1:193711206-193711228 ATGGAAGGACAGATTAACACTGG - Intergenic
919247386 1:195005680-195005702 CTGGAAGGAAAGATGGCCAGAGG - Intergenic
919866745 1:201788445-201788467 CTGGAAGGACAGAGGGAAGGGGG - Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920507788 1:206528918-206528940 CTGAAAGGAAAGAAGGCCAAGGG + Intronic
920755495 1:208727114-208727136 CAGGAAGAAGAGATGGACAACGG + Intergenic
920836519 1:209515779-209515801 ATGGTAGTAAAGATGGACAAAGG - Intergenic
921274238 1:213502247-213502269 CTGGGATGACAGATTGAGAATGG + Intergenic
921303963 1:213777414-213777436 ATGGAAGAACAGCTGGTCAATGG + Intergenic
921568063 1:216744732-216744754 CTAGAAGAACAGATGGAAGATGG - Intronic
921796666 1:219352643-219352665 CTGGAAGGACACTTGAAGAAAGG - Intergenic
922309952 1:224379046-224379068 CTGAAAGGATAGAAGGAAAAAGG - Exonic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923366834 1:233270036-233270058 ATGGATGACCAGATGGACAAAGG - Intronic
923493119 1:234501773-234501795 CTGGAAGGACACCTGGAAACGGG + Intergenic
924743670 1:246813167-246813189 CTGAAAGAACTGATGGAAAAAGG + Intergenic
1062970600 10:1645335-1645357 CTGGGAGGTTAGATGGACCAGGG + Intronic
1063217823 10:3939716-3939738 CTGGTTGGACAGATGGGAAAAGG - Intergenic
1063361579 10:5463429-5463451 CTGGAAGAACAGAGGTCCAAAGG - Intergenic
1063363808 10:5477958-5477980 TCCAAAGGACAGATGGACAAGGG - Intergenic
1064001606 10:11668197-11668219 CTGGAAGAAGGGATGGAAAAGGG + Intergenic
1064853784 10:19741539-19741561 CTAGGAGGATAGATGGGCAATGG - Intronic
1064963016 10:20987341-20987363 CAGGGAGGAGAGATGAACAAAGG - Intronic
1066360691 10:34727442-34727464 CTGGAAGGACTGATGTACTTTGG - Intronic
1066489702 10:35882857-35882879 CTGGAGGGACAGATGCAGACAGG + Intergenic
1067260250 10:44683268-44683290 CTGGAAGGCCAGCTGTACCAAGG + Intergenic
1067371407 10:45686769-45686791 ATGGAAGGACAGGTGGACTTGGG + Intergenic
1067388377 10:45839380-45839402 ATGGAAGGACAGGTGGACTTGGG - Intronic
1067417692 10:46117577-46117599 ATGGAAGGACAGGTGGACTTGGG + Intergenic
1067445890 10:46345198-46345220 ATGGAAGGACAGGTGGACTTTGG + Intergenic
1067503104 10:46824465-46824487 ATGGAAGGACAGGTGGACTTGGG + Intergenic
1067874878 10:49996683-49996705 ATGGAAGGACAGGTGGACTTGGG + Intronic
1068318998 10:55385304-55385326 GTGGAAGGACAGATTACCAATGG + Intronic
1072407784 10:95170722-95170744 CTGGAAGGACAGATGCCCTTGGG - Intergenic
1072722048 10:97787160-97787182 AGAGATGGACAGATGGACAAAGG - Intergenic
1073136439 10:101223038-101223060 CTGGGGGAACAGATGGGCAAAGG + Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074233770 10:111564140-111564162 CTGGAAGGGCAGTGGGTCAAAGG + Intergenic
1074546534 10:114405316-114405338 CTGGAAGGACCGGTGGCAAAAGG - Intergenic
1076075623 10:127531703-127531725 CAGGAATGCCAGATGGGCAAAGG - Intergenic
1076470220 10:130713555-130713577 CTGTGTGGACAGAAGGACAAGGG + Intergenic
1076504788 10:130964467-130964489 CAGGAAGGACAGATGGATGGTGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076991643 11:279009-279031 GTGGAAGGACAGAAGCAGAAAGG + Intronic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280559 11:1743165-1743187 ATGGATGGACAGATGAAGAATGG + Intronic
1077280564 11:1743203-1743225 ATGGATGGACAGATGAAGAATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280579 11:1743297-1743319 ATGGATGGACAGATGAAGAATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1077433888 11:2529113-2529135 CAGGCAGGACAGATGGACTGTGG - Intronic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1078107215 11:8365881-8365903 CTGGAAGGACAAATGGAGAGGGG - Intergenic
1078414683 11:11155780-11155802 TGGCAAGGACTGATGGACAATGG + Intergenic
1081534476 11:43987172-43987194 ATGGATGGAAGGATGGACAAAGG - Intergenic
1082078707 11:47995424-47995446 CAGGAAGGACAGCTGGACTTGGG + Intronic
1082674894 11:56085134-56085156 CTGGAATGATAGATGAACATAGG - Intergenic
1084352379 11:68611553-68611575 AAAGAAGGACAGATGGATAAAGG - Intronic
1084375384 11:68773280-68773302 CTGGAGGGCCAGCTGCACAAAGG + Exonic
1084671834 11:70611540-70611562 TTGGAAGGACAGAGTGACATGGG + Intronic
1084718988 11:70892142-70892164 ATGGATGGACTGATGGACTAAGG - Intronic
1085051836 11:73383976-73383998 CTGGAAACACAGCTGGACACAGG - Intronic
1085462534 11:76702711-76702733 AGGGATGGATAGATGGACAATGG + Intergenic
1085531996 11:77197458-77197480 CTGGAAGGAGAGAGGGACAGAGG - Intronic
1085795190 11:79532899-79532921 GTGGAAGGACATGTGGGCAAAGG + Intergenic
1085885217 11:80513619-80513641 CTCCACGGACAGATGGACATTGG + Intergenic
1086882087 11:92161110-92161132 CTGAAAGGAAAGAGGGGCAAGGG + Intergenic
1088036945 11:105328780-105328802 CTGGAAGGACAGATGACCAGAGG + Intergenic
1089838616 11:121394025-121394047 CAGGAAGGACTGCAGGACAAAGG - Intergenic
1090005406 11:122998091-122998113 CTGGAAAGAAAGTTGAACAAGGG + Intergenic
1091638001 12:2212821-2212843 CTGGTGGGAGGGATGGACAAAGG + Intronic
1092019885 12:5192514-5192536 ATGGAAGGAAAGGTGGACATGGG + Intergenic
1092233713 12:6792593-6792615 TGGGAGGGACACATGGACAAAGG - Intronic
1093225199 12:16474636-16474658 GGGGAAGGACAGAGGGAGAAAGG - Intronic
1094200510 12:27790644-27790666 CTTGAAAAAGAGATGGACAATGG - Intronic
1095095678 12:38147194-38147216 GTGGGAGAACAGATGGACAGAGG - Intergenic
1096499611 12:52056728-52056750 CTGGAAGGACTGAATGAGAAAGG + Intronic
1096875241 12:54624893-54624915 AAGGAAGGACAGAAGGAGAAGGG - Intergenic
1097141236 12:56903816-56903838 CTGGAAAGAGAGAGGAACAAAGG + Intergenic
1097500102 12:60391426-60391448 CTGTATGGACTGTTGGACAAGGG - Intergenic
1098369557 12:69742148-69742170 GAGGAAGGACAGATGGATAGTGG + Intronic
1099694623 12:86002089-86002111 CTGGGAGGACAGGTAGACAGAGG - Intronic
1101417894 12:104524559-104524581 ATGGAAGGAGGGATGGAAAATGG - Intronic
1101492502 12:105222498-105222520 GTGGAAGGCCAGATGGAGAACGG + Intronic
1101713168 12:107287509-107287531 CTGGAAGGACAGGGAGGCAAAGG + Intergenic
1102233202 12:111277599-111277621 CTAGAGGGAATGATGGACAAAGG - Intronic
1102362778 12:112302644-112302666 CTGAAAGGAAAGAAGGCCAAGGG - Intronic
1103884813 12:124192346-124192368 CAGGGAGGAAAGATGGCCAAGGG + Intronic
1103905447 12:124325258-124325280 CTGGACGGACAGATGGATGGAGG + Exonic
1103960934 12:124608964-124608986 CTGGAAGGACACACAGACACTGG + Intergenic
1103999947 12:124854149-124854171 CTGGCAGCACAGGGGGACAAGGG + Intronic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104772618 12:131372966-131372988 ATGGATGGAAGGATGGACAAAGG - Intergenic
1104898071 12:132173899-132173921 CCGGAGGGACACATGGAAAATGG - Intergenic
1104900965 12:132189356-132189378 ATGGACGGACAGACGGACACAGG - Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106679601 13:31996654-31996676 CTGGAAGAGCAGATGGAAAGTGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1108948333 13:56053144-56053166 TTGGAAGGAAAGATGGTTAAAGG + Intergenic
1109442059 13:62387534-62387556 CTTGGAGGAAATATGGACAATGG - Intergenic
1110216413 13:73029502-73029524 CTGGAAGAAGAGAGAGACAAAGG - Intergenic
1110932613 13:81241176-81241198 CAGGAAGGTCAAATGGAGAATGG + Intergenic
1111097851 13:83538225-83538247 CTTTAAGGTCAAATGGACAATGG - Intergenic
1111685242 13:91493671-91493693 ATGGAAGAGCAAATGGACAAGGG - Intronic
1112737151 13:102433315-102433337 CTGGAAGGGCAGAGGAAGAAAGG + Intergenic
1113433129 13:110267313-110267335 CAAGAAGGACAGAGGGAGAACGG + Intronic
1113634829 13:111912432-111912454 CAGGGAGGAAAAATGGACAATGG - Intergenic
1114488606 14:23080810-23080832 CTGAAAGAACAGATACACAATGG + Intronic
1114528714 14:23381959-23381981 CAGGAAGGACAGATGGGCTCAGG + Intergenic
1114988346 14:28258300-28258322 CTGAAAGGAAAGATGGTCAAAGG - Intergenic
1115281911 14:31672947-31672969 CTGGAAGGATGGACGGGCAAAGG + Intronic
1118730801 14:68664974-68664996 CTGAAAGGACAGAAGGAACATGG - Intronic
1118809873 14:69265265-69265287 CTGGAAGGCCAGAGGTCCAAGGG + Intronic
1119978560 14:79053774-79053796 CTGGAAGGCCAGCAGGATAATGG + Intronic
1120127932 14:80769078-80769100 CTGAAATGAAATATGGACAAGGG + Intronic
1121008055 14:90502916-90502938 GTGGAAGGATAGAAGGATAAAGG + Intergenic
1121163987 14:91774422-91774444 GGGGAAGGACCTATGGACAAGGG - Intronic
1121280350 14:92692998-92693020 CAGGAAGGTCACATGGAGAAGGG + Intergenic
1121783995 14:96640853-96640875 GTTGAAGGTCAGATTGACAAGGG + Intergenic
1121812939 14:96907553-96907575 AAGGAAGGGCAGATGGACAGTGG + Intronic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1122854356 14:104552997-104553019 CTGGAAGGACAGAGAGGGAAAGG + Intronic
1122877508 14:104675641-104675663 ATGGATGGACAGATGGATAATGG + Intergenic
1124640559 15:31393518-31393540 GTGGGAGGACCGAGGGACAAGGG - Intronic
1126349637 15:47730910-47730932 CTGAAAGGAAAGAAGGCCAAGGG - Intronic
1128356773 15:66933659-66933681 CTGGAAGGAGGGATGGGGAATGG - Intergenic
1129844016 15:78760013-78760035 CTGGCAGGACAGATGCACTGGGG - Intronic
1129990096 15:79954686-79954708 CTGGGAGGACACATGCAAAAGGG + Intergenic
1130257790 15:82333787-82333809 CTGGCAGGACAGATGCACTGGGG + Intergenic
1130597146 15:85256176-85256198 CTGGCAGGACAGATGCACTGGGG - Intergenic
1131269853 15:90940510-90940532 ATGGATGGACAGACAGACAAAGG - Intronic
1131671527 15:94624884-94624906 GTGGAGGGAGAGAGGGACAAGGG + Intergenic
1131985832 15:98042184-98042206 CAGGAAGGACAGATGGGTATGGG - Intergenic
1132592582 16:732604-732626 GAGGATGGACAGATGGACACTGG - Intronic
1133663004 16:7937130-7937152 CAGGAAGGACAAAGGGAGAAAGG + Intergenic
1134216421 16:12320197-12320219 CTGGAAGGACACCTGCACAGAGG - Intronic
1137755366 16:50897807-50897829 ATGGATGGACATATGGACATTGG + Intergenic
1137785105 16:51132102-51132124 CGTGAAGGGCAGATGGACAGAGG - Intergenic
1138519894 16:57565011-57565033 CTGGAAGGGCAGCAGGAGAAGGG - Intronic
1139611114 16:68059462-68059484 GTGGAAGGACAGATGGAGCCAGG + Intronic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141623548 16:85249682-85249704 CTGCGGGGACAGCTGGACAACGG - Intergenic
1141650214 16:85388740-85388762 AAGGAAGGAAAGATGGAAAAAGG + Intergenic
1141795825 16:86273577-86273599 GTGGAAGGACCTATGGGCAATGG - Intergenic
1141832781 16:86519008-86519030 ATGAAATGACAGATGGACAGAGG + Intergenic
1143009981 17:3860916-3860938 CTGGAAACATGGATGGACAAGGG - Intronic
1143484181 17:7244006-7244028 CTGGATGGACACATGGGCCAGGG - Exonic
1143870387 17:9954018-9954040 CTGGAAGGACTGAGGGTCCAGGG + Intronic
1144261819 17:13528840-13528862 CGGGATGGACACATGCACAAAGG + Intronic
1144556471 17:16286876-16286898 CGGGAAGGAGAGATGGGCAGGGG - Intronic
1146291511 17:31610848-31610870 ATGGAAGAACAGAAGTACAAGGG - Intergenic
1146562818 17:33886181-33886203 CTGGCTGAAGAGATGGACAAAGG + Intronic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1147424596 17:40340169-40340191 CTGGAAGTGCTGATGGACAGAGG - Intronic
1148091965 17:45028016-45028038 CAGGAAGGACAAATGGCCAGAGG + Intronic
1148478726 17:47946169-47946191 CAGGATGGCCAGATGGACAGAGG - Intronic
1148717690 17:49727625-49727647 GTGGAAGGACAGCTGGGCATGGG + Intronic
1148870940 17:50658540-50658562 ATGGAAGGTGAGATGGAGAAAGG + Intronic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149446580 17:56717854-56717876 CTGGTAGGGCAGAAGGACACTGG - Intergenic
1150161039 17:62898416-62898438 CTGGAAGGACATTTGGAAAGAGG + Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150842374 17:68620749-68620771 CTGGAGGGAAGGATGGAAAAAGG + Intergenic
1151420264 17:73992500-73992522 CAGGAAGGAAAGAAAGACAACGG + Intergenic
1151715713 17:75830117-75830139 CTCCAAGGTCAGCTGGACAAAGG + Exonic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152559598 17:81071332-81071354 GGGGAAGGACAGATGGCCAGGGG - Intronic
1152626365 17:81389547-81389569 CTGGAGGGGCAGCAGGACAATGG + Intergenic
1152646416 17:81470813-81470835 ATGGATGGGCAGATGGACACAGG - Intergenic
1152757804 17:82094246-82094268 CGGGAAGGAGAGAGGGACACCGG + Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153374075 18:4356052-4356074 CTGGAGTGACAGATGTGCAATGG - Intronic
1153428445 18:4990611-4990633 CTGGAAAGAAAAATGAACAAAGG - Intergenic
1154121879 18:11658752-11658774 AGGGAAGGAGAGATGGAGAAGGG - Intergenic
1155551632 18:26971793-26971815 CTGGAAGGACAGAGCGCCCATGG + Intronic
1155740147 18:29279316-29279338 GTGGAAGGAAAGAGGTACAAAGG - Intergenic
1155989991 18:32270304-32270326 ATGGAGGGACTGGTGGACAAAGG + Exonic
1156396590 18:36704901-36704923 CTGGAAGAACACATGGGTAAGGG - Intronic
1158290721 18:55938932-55938954 CAGGAATGAAAAATGGACAAGGG + Intergenic
1158821786 18:61168238-61168260 ATGAAAGGACATCTGGACAATGG - Intergenic
1160090887 18:75825677-75825699 CTGGAAGGTCAGATGCACCTAGG - Intergenic
1160572820 18:79830559-79830581 CTGGAGGGACCCATGGCCAAAGG - Intergenic
1160681772 19:414952-414974 ATGGATGGACAGATGGAAAATGG + Intergenic
1161258516 19:3322891-3322913 GTGGATGGATAGATGGATAAAGG + Intergenic
1161258539 19:3322991-3323013 GTGGATGGATAGATGGACAAAGG + Intergenic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1162045259 19:7995381-7995403 ATGGACGGTGAGATGGACAATGG + Intronic
1162082260 19:8225215-8225237 TGGGAAGGAGGGATGGACAAGGG + Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164130129 19:22354545-22354567 GTGGAAGGACAGAGGGACCCAGG - Intergenic
1164222053 19:23203827-23203849 CGGGAAGGACAGAGGGACCCAGG - Intergenic
1164669382 19:30064010-30064032 CTGGAAGGACATGGGCACAACGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164812600 19:31169754-31169776 CTCAAAGGACACATGGCCAAGGG - Intergenic
1165927454 19:39335814-39335836 CTGGAAGAACAGAGAGACAGTGG - Intronic
1166379474 19:42348366-42348388 CTGGAGGGCCAGGTGGACCAGGG + Exonic
1166576250 19:43841000-43841022 CTGGAAAGACAGATTGTCATTGG - Intronic
1166720447 19:44993094-44993116 CTGGAAACACAGAGGGACAGAGG - Exonic
1166981707 19:46635285-46635307 TCGGATGGACAGAGGGACAACGG + Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167233775 19:48301731-48301753 CTGGATGGATGGATGGACATGGG + Intronic
1167233919 19:48302508-48302530 ATGGATGGATAGATGGACATGGG + Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
925359045 2:3264551-3264573 CGGGCAGGACAGATGAAAAAAGG + Intronic
929437479 2:41939572-41939594 TAGGAAGGACAGATGGATGAGGG - Intronic
929804244 2:45130721-45130743 CTTGAAGGGGAGATGGACAAGGG + Intergenic
929812491 2:45202262-45202284 CAGGGAGAAGAGATGGACAAAGG + Intergenic
930774068 2:55155370-55155392 CGGGAAGGACACAGAGACAAGGG - Intergenic
931097150 2:58954014-58954036 CTGGAAGGACAGGTGAAGATGGG - Intergenic
931934307 2:67178917-67178939 TTGGAAGGAGAGTTGCACAAAGG - Intergenic
932721963 2:74145117-74145139 TTGGAAGGACAGAGGGTCAGGGG - Intronic
932892082 2:75606149-75606171 ATGGGTGGATAGATGGACAAAGG + Intergenic
933691079 2:85180073-85180095 CTGCAAGGACTGTTGGAGAAAGG + Intronic
933989723 2:87625500-87625522 CTGGAAAGGCAGATCAACAAAGG + Intergenic
934735820 2:96689341-96689363 CTGGCAGGACAGCTGGACAGTGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
936085704 2:109467485-109467507 CTGGAAGGACAGCAGGACTGGGG + Intronic
936304121 2:111325326-111325348 CTGGAAAGGCAGATCAACAAAGG - Intergenic
937350368 2:121156620-121156642 CTCGGAGGGCAGATGGACAGGGG - Intergenic
937474331 2:122201682-122201704 CTGGAAGGAGAGATGGCCAAAGG - Intergenic
937701881 2:124871655-124871677 ATAGCAGGACAGATGGACAGCGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939107955 2:137971556-137971578 CTGGAAAGGTAGATGGACACAGG + Intronic
939220429 2:139294579-139294601 GTGGAAGGAAAGAAGGAGAAAGG + Intergenic
945144113 2:206718292-206718314 CTGGAATGACAGATGGCAAGTGG + Exonic
945231103 2:207591234-207591256 CTGAAAGGAGAAATGAACAAAGG - Intronic
946064142 2:216971947-216971969 ATGGAAGCAGAGCTGGACAATGG + Intergenic
946229298 2:218281910-218281932 CTGGAAGGGCAGATGGAAGGTGG - Intronic
946552849 2:220822564-220822586 CTGGAGGGACAGATGAGGAAGGG - Intergenic
946912226 2:224475665-224475687 CTGGAAGAAAAGAAGGGCAAAGG - Intronic
946944163 2:224802581-224802603 CTGGAAGCACAGAGGCACAGAGG - Intronic
947699245 2:232218580-232218602 CTGGAGGGGCAGCAGGACAAGGG + Intronic
948122322 2:235540053-235540075 CAGGATGGACAGATGGACAGTGG + Intronic
949066020 2:241990681-241990703 CAGGGATGACAGATGGACAGAGG - Intergenic
1169602720 20:7280381-7280403 CTGCAAGGAGAAATGGAAAAGGG - Intergenic
1170140922 20:13124292-13124314 CTGGAAGGAAAGATGGAAGGGGG + Intronic
1170276267 20:14593721-14593743 CTGGAAGGATACAAAGACAAAGG - Intronic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171289616 20:23974704-23974726 ATGGGTGGACAGATGGACAATGG - Intergenic
1171572111 20:26262585-26262607 GAGCAAGGACAGATGGTCAATGG + Intergenic
1172179914 20:32996607-32996629 TTGGAAGAACAGATGGATAAGGG - Intronic
1173013071 20:39200090-39200112 CTGGCCTGACAGATGGAAAAGGG + Intergenic
1173251128 20:41364770-41364792 CAGGAACCACAGAGGGACAAGGG - Intronic
1173577794 20:44124208-44124230 CTGGGAGGAGAGATGGGGAAAGG - Intronic
1173871520 20:46344999-46345021 ATGGATGGAGAGATGGATAATGG - Intergenic
1173932070 20:46829176-46829198 CTGGAAGGATATATGGAAAACGG + Intergenic
1174098366 20:48107526-48107548 CTGGAAGGAGGGCTGGACATAGG - Intergenic
1174264908 20:49324280-49324302 CTGGCTGGACAGCTGGACCAAGG - Intergenic
1174358526 20:50014102-50014124 CTGTAAAGAGACATGGACAAAGG + Intergenic
1175696263 20:61105453-61105475 AGGGAAGGAAAGATAGACAATGG + Intergenic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175818860 20:61897761-61897783 CTGGAACCAAGGATGGACAATGG - Intronic
1178193423 21:30314267-30314289 ATATAAAGACAGATGGACAATGG - Intergenic
1178740208 21:35192951-35192973 GTGGAAGTTAAGATGGACAAAGG - Intronic
1179026443 21:37682842-37682864 CTGCAGGGACAGATGGCCCAGGG - Intronic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1179336693 21:40463450-40463472 CTGGAAGAACTGATGGAAGAAGG - Intronic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1179541138 21:42083873-42083895 CTGGAAGGACAGATGGGCAGAGG + Intronic
1179623649 21:42634720-42634742 GTGGATGAATAGATGGACAATGG - Intergenic
1179623662 21:42634834-42634856 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623676 21:42634944-42634966 GTGGATGAATAGATGGACAATGG - Intergenic
1179623690 21:42635050-42635072 GTGGATGAATAGATGGACAATGG - Intergenic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179623720 21:42635278-42635300 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623732 21:42635384-42635406 GTGGATGAATAGATGGACAATGG - Intergenic
1179623744 21:42635490-42635512 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623759 21:42635604-42635626 GTGGATGAATAGATGGACAATGG - Intergenic
1180182440 21:46124021-46124043 GTGGATGGACAGACGGACAGTGG + Intronic
1180243226 21:46526236-46526258 ATGGAGGGACAGATGTCCAAGGG - Intronic
1181795186 22:25303058-25303080 AGGGAAGGAAAGATGGAGAAGGG - Intergenic
1181835728 22:25606578-25606600 AGGGAAGGAAAGATGGAGAAGGG - Intronic
1182100769 22:27655915-27655937 CTAGAGGGACAGATGGATGAGGG + Intergenic
1182358940 22:29735384-29735406 CTGGGTGGCCAGAGGGACAATGG + Intronic
1182466547 22:30520413-30520435 CTGGAAGAACAGATGGGCCCTGG - Intergenic
1183168888 22:36169937-36169959 CTAGCAGGACAGATGTAAAATGG - Intergenic
1183249794 22:36722351-36722373 CTGGAAAGACCCATGGACAGAGG - Intergenic
1183269595 22:36852669-36852691 CTGGAAGGGGAGATGGGAAATGG + Intergenic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184513527 22:44946541-44946563 ATGGAAGGGTAGATGGACAGTGG + Intronic
1184615618 22:45636227-45636249 CTGGAAGGTCAGATGGGGATGGG + Intergenic
1185212921 22:49581940-49581962 ATGGATGGACAGATGAATAATGG - Intronic
949262388 3:2117502-2117524 CTGGAAGGAAAGAGGGACTGAGG - Intronic
949584849 3:5427491-5427513 TTGGAATGACAACTGGACAATGG + Intergenic
950003791 3:9678181-9678203 CTGAGAGGACAGAGGGCCAAAGG - Intronic
950158180 3:10739502-10739524 CTGTGAGGACAGAGGGGCAAGGG - Intergenic
950356287 3:12412697-12412719 CTGGAAGGACTTCTGCACAAGGG - Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
951690215 3:25387244-25387266 CTGGATGGACAGGAGGACACTGG + Intronic
951858356 3:27223421-27223443 TTGGATGTGCAGATGGACAATGG - Intronic
953038096 3:39230699-39230721 CTGGAAGGATAGAAGGATAAAGG - Intergenic
953173658 3:40529883-40529905 CTGGATGGACAAAGGAACAAAGG - Intronic
953449955 3:42997598-42997620 CTGGAATAACAGCTGCACAATGG + Intronic
953712198 3:45283426-45283448 CTGGAAGGAAAGATGGCCAGAGG - Intergenic
953886555 3:46717541-46717563 CTGGAAGGACAGGTGGCCTTGGG + Exonic
954361898 3:50126567-50126589 GAGGGAGGACAGATGGACAGCGG - Intergenic
954623675 3:52010403-52010425 ATGGATGGACAGATGGATAGAGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956329312 3:68087647-68087669 ATGGATGGATATATGGACAAAGG - Intronic
956426763 3:69144326-69144348 GGGGAAGGAGAGATGGGCAAGGG + Intergenic
957296126 3:78335190-78335212 CTGCAAAGACAGATGGGTAATGG - Intergenic
957512070 3:81201867-81201889 CTGAAAGGACAGAGGAACAGAGG + Intergenic
959012590 3:101095483-101095505 GTGGAAGAACAGATGGGCAAGGG + Intergenic
959300108 3:104588124-104588146 ATGGAAGGACAGATAGTTAAGGG + Intergenic
960057229 3:113284312-113284334 CTGGAAGGACAGAAAAATAAAGG - Intronic
960248151 3:115422374-115422396 CAGGATGGACAGAAGGGCAAAGG + Intergenic
961387362 3:126530122-126530144 ATGGAGGGACAGATGGGCACAGG - Intronic
961493880 3:127276478-127276500 CTGGAAGGAGAAAGGAACAAAGG + Intergenic
962033845 3:131630173-131630195 CAGGTAGAATAGATGGACAAAGG - Intronic
962410100 3:135133413-135133435 ATGGATGGACAGATGGACAGAGG + Intronic
962429909 3:135309460-135309482 CTGGAAGGACAGATGAGCTGAGG - Intergenic
967080124 3:186042281-186042303 GAGGAAGGAGAGAGGGACAATGG - Intergenic
967283300 3:187843535-187843557 CTAGAAGGACAGATAGAAATAGG - Intergenic
968547039 4:1204596-1204618 CTGGAACAAAAGATGAACAAGGG - Intronic
968642062 4:1719938-1719960 CTGGGAGGACAGATGGCCAGTGG - Intronic
968928105 4:3560607-3560629 GTGGATGGACAGATGGGGAATGG - Intergenic
968984091 4:3866013-3866035 CGGGTGGGACAGATGGACACGGG + Intergenic
969341337 4:6543601-6543623 CTAGCAGGACAGCTGGCCAAGGG + Intronic
969424813 4:7118025-7118047 ATGGAAGGATGGATGGACACAGG + Intergenic
969694916 4:8729108-8729130 CTAGACAGACAGATGGACACTGG + Intergenic
969904435 4:10381045-10381067 CCAGAAGCACAGATGGACAAGGG - Intergenic
971029404 4:22620688-22620710 CTGGAAGGACAGAGCGCCCATGG + Intergenic
971603282 4:28623725-28623747 CAGGAATGAGAGATGGAAAAGGG - Intergenic
972995298 4:44871467-44871489 ATGGAAGAAAAGATGAACAATGG - Intergenic
973767443 4:54176059-54176081 CTAGAAGGACAGATGGAGAGAGG + Intronic
974475561 4:62374768-62374790 ATGGAAGGACAGAGGAAGAAAGG - Intergenic
974525849 4:63049379-63049401 ATGCAAGGACAGATGGGCAGTGG - Intergenic
976698690 4:87945966-87945988 GTGGAATGACAAAAGGACAAAGG + Intergenic
978804828 4:112788853-112788875 CTGAAAGGAAAGAAGGCCAAGGG - Intergenic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982215512 4:153079795-153079817 AGGGAAGGTCAGATGGACAGAGG - Intergenic
982419989 4:155183531-155183553 CTGGAAGAAGAGATGGCCAGAGG + Intergenic
985110333 4:186541316-186541338 CTGGAAGGAGAGAGGGCCACAGG + Intronic
985446521 4:190023798-190023820 AGGGAAGGACAGAGGGAGAAAGG - Intergenic
985709249 5:1419062-1419084 TAGGATGGACAGATGGATAATGG - Intronic
985723174 5:1501345-1501367 AGGGAAGGACAGATGGGCTAGGG + Intronic
986040311 5:3987892-3987914 ATGGAAGGGCAGATGGAAGAAGG + Intergenic
986815390 5:11404338-11404360 CTGGAGGGCCAGATCGATAATGG - Intronic
987238611 5:15969377-15969399 ATGCAAGGACAGAGGGACAGAGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
989090559 5:37725878-37725900 CTGGAAAGACAATTGGACAGTGG - Intronic
989975156 5:50576863-50576885 CAGGGAGGACAGATGGATAAAGG + Intergenic
990193823 5:53290585-53290607 CTGCAAGGGCAGAGGGCCAATGG - Intergenic
990664440 5:58055652-58055674 CTGGTAGGGCATATTGACAATGG - Intergenic
991573322 5:68077885-68077907 TTGGATGGCCAGCTGGACAATGG + Intergenic
992650464 5:78854647-78854669 CTGGTAGAGCAGATGCACAAAGG - Intronic
994169190 5:96640303-96640325 ATGGAAGGATGGATGGACAAAGG + Intronic
994965747 5:106668877-106668899 AAGGAAGGACAGAAGGAAAAAGG + Intergenic
995029755 5:107466741-107466763 CTGGTAGGTGAGATGCACAAAGG + Intronic
997569388 5:134914541-134914563 ATGGAGGAACAGAGGGACAAGGG + Intronic
999138980 5:149344902-149344924 CTGGGAGGAGTGATGGGCAATGG + Intergenic
999302518 5:150500040-150500062 CGGGACAGACAGTTGGACAAGGG - Intronic
999378955 5:151106588-151106610 CAGGAAGGACAGAGAGACACAGG - Intronic
999429580 5:151514624-151514646 CTGGAAGAACGGATGGACTCAGG - Intronic
999692429 5:154159928-154159950 CTGGAAGGACAGAGAGATAGTGG - Intronic
1001237963 5:170045790-170045812 CAGGAAGGTCACAGGGACAAAGG - Intronic
1002755527 6:156129-156151 CTTGAGGGACAGATGTGCAAAGG + Intergenic
1003116253 6:3285621-3285643 CTGGAAGGGCAGCTGGGGAACGG + Intronic
1003224122 6:4189389-4189411 CTGGAAGGACAGAGAGAAACGGG + Intergenic
1004473144 6:15946918-15946940 ATGGGAGGACAGATGGACTGTGG + Intergenic
1004934894 6:20497527-20497549 TTGGAAGGACAGATGGTTAGAGG + Intergenic
1005890762 6:30135977-30135999 CTGGAAGGTGAGATGGACTTTGG - Intergenic
1006091092 6:31629493-31629515 CTCAAAGCACACATGGACAAAGG - Intronic
1006180314 6:32150269-32150291 CTGGTAGGATAGAGGAACAAGGG - Intronic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1006813675 6:36837059-36837081 CTGGAAGTAAAGATGTCCAAAGG - Intronic
1007499904 6:42288734-42288756 CGTCAAGGACAGATGGGCAAAGG + Intronic
1007667641 6:43524846-43524868 CTGGAAGGCCAGATGGACCAGGG + Exonic
1009604898 6:65854841-65854863 CAGTAAGGACAGATTGGCAAAGG + Intergenic
1012857781 6:104523491-104523513 CTAGAACAACAGATGGACATTGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014285756 6:119495553-119495575 CTGGCATGACAGATGGCCATAGG + Intergenic
1015214539 6:130734708-130734730 CTGGAAGGGAAAATGGACTAGGG - Intergenic
1015769023 6:136750058-136750080 CTGGAAGGACAGAAGGCCAATGG - Intronic
1016430858 6:143983776-143983798 GTGGGAGGACAGATGGAGAATGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017769509 6:157634344-157634366 CTGGAAGGAAAGGTGGCCCAGGG + Intronic
1018631460 6:165826351-165826373 ATGCAAGGACAGAGGGACACGGG - Intronic
1019288856 7:237301-237323 GGGGAAGGAGAGAGGGACAAAGG + Intronic
1019704869 7:2492764-2492786 GTGGATGGATAGATGGACAGAGG - Intergenic
1020578377 7:9963397-9963419 CCTGAAGGACAGATGGAATAGGG + Intergenic
1022236516 7:28467005-28467027 CTGGAGGGACAGGGGGCCAAGGG + Intronic
1022533347 7:31080660-31080682 CTGGATGGACAGAAAGACAGCGG - Intronic
1022827620 7:34032252-34032274 CTGGAAGTACATATGGTTAAGGG - Intronic
1022971948 7:35526470-35526492 ATGGAAGGACAGATTGACTCTGG - Intergenic
1024466098 7:49712510-49712532 CTGGAGGGACAGATGCACCTGGG - Intergenic
1024467210 7:49723862-49723884 CTGGAATTACAGATCAACAAGGG - Intergenic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1026901680 7:74040771-74040793 ATGGAAGGACAGATGGGTAGTGG + Intronic
1027224682 7:76236491-76236513 TTGGAAGGACTGAAGGACACAGG - Intronic
1029045777 7:97626543-97626565 AAGGAAGGAAGGATGGACAATGG + Intergenic
1029361544 7:100091798-100091820 CTTGAAGGGCTGATGGACAGGGG + Exonic
1030244211 7:107363159-107363181 CTGGAAAGTCAGAGAGACAATGG + Intronic
1031692882 7:124812651-124812673 CTGAAAGCACAGATGAACACAGG - Intergenic
1032445331 7:131977566-131977588 ATGAAAGGACAGAAGGTCAAGGG - Intergenic
1032497775 7:132375669-132375691 CAGGAAGGACAGATCAAAAAAGG + Intronic
1032541980 7:132710817-132710839 GAGGAAGGACAGATGGCCATGGG - Intronic
1033234172 7:139625105-139625127 TTGGAAGGATAGATGGACGAGGG - Intronic
1034226989 7:149491881-149491903 AGGGAAGGACAGGTGGACACAGG - Intronic
1034242124 7:149618636-149618658 AGGGAAGGACAGATGGACACAGG - Intergenic
1034434314 7:151055849-151055871 CTGGGAGGAGAGAGGGAGAAGGG + Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1035647963 8:1242908-1242930 ATGGATGGACAGATAGACAGTGG + Intergenic
1037280441 8:17235640-17235662 TTGGAAGGAAAGGTAGACAAGGG - Intronic
1038679627 8:29654716-29654738 CTGGAATGACCGACGCACAAAGG + Intergenic
1038882011 8:31625248-31625270 GTGGAAGGAGAAATGGAAAATGG + Intergenic
1039396860 8:37233803-37233825 CCAGAAGGACAGGTGGTCAATGG - Intergenic
1040835460 8:51725783-51725805 CTGCAAGGACAGATAGTAAATGG + Intronic
1041691141 8:60688543-60688565 CTGGTTGCACTGATGGACAAAGG - Intronic
1044627852 8:94251811-94251833 CAGGTAGACCAGATGGACAAGGG + Intronic
1044921003 8:97169477-97169499 ATGGCAGCACAGATGGACTAAGG - Intergenic
1044974532 8:97650583-97650605 CTTGAAGGACAGGTGGAAATTGG - Intronic
1045628598 8:104087387-104087409 ATGGATGGATGGATGGACAAGGG + Intronic
1045785010 8:105910719-105910741 CTGAAAGGCCACTTGGACAACGG + Intergenic
1047982954 8:130202333-130202355 TTACAAGGAAAGATGGACAAAGG - Intronic
1048278978 8:133090753-133090775 CTGGAAGCTCAGAAAGACAAAGG + Intronic
1048833909 8:138500330-138500352 CAGATAGGACAGATGGACACTGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049350585 8:142162409-142162431 GTGGATGGATAGATGGACAGAGG + Intergenic
1049364272 8:142229175-142229197 ATGGATGGACAGATGGTGAATGG + Intronic
1049672797 8:143877295-143877317 CTGGGAGGGCAGCTGGACAGAGG + Intronic
1050458749 9:5858815-5858837 CTGGAAGGATGGATGGATGATGG + Intergenic
1051004508 9:12326869-12326891 TGGGAAGGACAGATGGATGAGGG - Intergenic
1052026640 9:23580961-23580983 CTGGAATGAGGGGTGGACAAAGG - Intergenic
1052340119 9:27356783-27356805 CAGAGAGGAAAGATGGACAAGGG - Intronic
1057706536 9:97398995-97399017 CTGGAGGGGGAGATGGACAAAGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1060079991 9:120634884-120634906 CTGTTAGAAAAGATGGACAAAGG - Intronic
1060291060 9:122303226-122303248 CTGGAAGGATATACTGACAATGG - Intronic
1060985698 9:127817874-127817896 ATGGATGGATAGATGGACAGTGG + Intronic
1061244819 9:129396085-129396107 ATGGCAGGACGGATGGAGAATGG + Intergenic
1061995088 9:134179140-134179162 CTGGAAAGACAGAGGAACACGGG - Intergenic
1185874552 X:3691882-3691904 ATGGATGGATGGATGGACAATGG + Intronic
1186306463 X:8264947-8264969 CAGAAAGGAGAGAAGGACAAGGG - Intergenic
1186987666 X:15034254-15034276 GTGTGAGGACAGATGGAGAATGG + Intergenic
1187474960 X:19602396-19602418 CTGTAAGTACAGCTGGAGAAGGG + Intronic
1188572845 X:31610062-31610084 CAGGAAGGACAGAGGGAGAATGG - Intronic
1189615261 X:42776686-42776708 CTGGGAGGACTGAGGAACAAAGG + Intergenic
1190219072 X:48499355-48499377 ATGGATGGACAGATGGACAGTGG + Intergenic
1190327047 X:49212913-49212935 ATGGAGGGACAGAGGGACATGGG + Intronic
1192568829 X:72185420-72185442 GTGGAAGCACAGAGGGACACTGG - Intronic
1200939174 Y:8764580-8764602 CTAGAATGACAGATGGTCACTGG + Intergenic
1201362071 Y:13163333-13163355 ATGGAAGGAAAGAGGGACATTGG + Intergenic
1201866313 Y:18659242-18659264 CTGGAAGGCCATATGCACACTGG + Intergenic