ID: 913530742

View in Genome Browser
Species Human (GRCh38)
Location 1:119732649-119732671
Sequence ATTTATCTGCAGATGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913530742_913530743 0 Left 913530742 1:119732649-119732671 CCTGCAGTCATCTGCAGATAAAT 0: 1
1: 0
2: 1
3: 36
4: 377
Right 913530743 1:119732672-119732694 GAGATACTCTCTGTGAAAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913530742 Original CRISPR ATTTATCTGCAGATGACTGC AGG (reversed) Intronic
900705539 1:4077883-4077905 CTGTGTCTGCAGATGACTGTTGG - Intergenic
900705561 1:4077999-4078021 CTGTGTCTGCAGATGACTGTTGG - Intergenic
901249109 1:7759614-7759636 ATTTCTCAGCAAATGACTGAAGG + Intronic
901892140 1:12275813-12275835 TTTTATCTTCAGATAACTCCAGG + Exonic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903087933 1:20880885-20880907 ATATATCTGCAGATCACTTTGGG - Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
907712717 1:56899150-56899172 ATGTATATGCAGATGACTTAAGG - Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909365555 1:74817307-74817329 TTTGAACTGCAGTTGACTGCAGG - Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910025550 1:82646874-82646896 ATGTTGCTGCAGATGACTGATGG + Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911662358 1:100515973-100515995 ATTTGTTTGCAGAGGCCTGCAGG + Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912749426 1:112273464-112273486 ATTTAATTCCAGATGACTACAGG - Intergenic
913530742 1:119732649-119732671 ATTTATCTGCAGATGACTGCAGG - Intronic
916017358 1:160761994-160762016 AGTTATCTGCAGCTGACTCCAGG + Intergenic
916882429 1:169032887-169032909 ATTTCTATGCAGATGCCAGCAGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918029565 1:180791607-180791629 ATTTATCTGTATATGTGTGCTGG - Intronic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG + Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069138818 10:64798924-64798946 ATTTTTCTGCACTTGACTTCTGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071168002 10:82829349-82829371 CTTTATCTGCAGATGAGGTCTGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072590360 10:96823386-96823408 ATTTATTTGAAAATTACTGCTGG - Intergenic
1073635025 10:105189068-105189090 ATTTATCTACATATGAATGTAGG + Intronic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073898716 10:108193781-108193803 ATTTATCTGCACATTATTGGGGG - Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076701188 10:132274118-132274140 ATCAGTCTGCAGATGCCTGCGGG + Intronic
1076729901 10:132433074-132433096 ATTTGTCTGCAGGTGCCCGCCGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078574044 11:12483654-12483676 CTGTAGCTGCAGATGAATGCAGG + Intronic
1079446587 11:20562285-20562307 AATTAACTGCAGATGTCTGAAGG + Intergenic
1080592853 11:33738437-33738459 ATTCATATCCAGCTGACTGCTGG + Intergenic
1080865634 11:36192414-36192436 TTTTCTCTGCAGGTAACTGCAGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083007937 11:59366360-59366382 ACTTCTCTGAACATGACTGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1087716271 11:101612470-101612492 AATTATCTCCTGAAGACTGCAGG + Intronic
1088132474 11:106510376-106510398 ATTCATCCCCTGATGACTGCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090589153 11:128246749-128246771 TTTTATCTGCAGGAGACTGTAGG + Intergenic
1090976258 11:131683067-131683089 ATTGCTGTGCAGATGACTGTGGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095339118 12:41067455-41067477 TTTTGTCTGAGGATGACTGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096198096 12:49662039-49662061 CTTTATCTGCAGGTGGGTGCGGG - Exonic
1096402970 12:51322894-51322916 ATTTATCAGCAGAAAACTGATGG - Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098240842 12:68465305-68465327 ATTCATCTGCAGAGTGCTGCTGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100203485 12:92324731-92324753 ATTTATCTGAAAAAGAATGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104217358 12:126747295-126747317 TTTTATTTGCAGAAGTCTGCAGG + Intergenic
1104396866 12:128441571-128441593 ACCTGTCTGCAGGTGACTGCAGG - Intronic
1104775998 12:131390513-131390535 ATTTATCTGCAGGTGTCTGCAGG + Intergenic
1107675046 13:42786940-42786962 ATTTATCTGGAAACGACTTCTGG - Intronic
1109339242 13:61033625-61033647 ATTTTTCTGCAAATTTCTGCTGG - Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1111019704 13:82432749-82432771 ATTTATTTGGAGATAATTGCTGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118501832 14:66369364-66369386 AGTTATCTGTGGATGATTGCAGG - Intergenic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119431658 14:74572100-74572122 ATCTGTCTGCAGATGACACCGGG - Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1121492656 14:94371284-94371306 GGTTGTCTGCAGGTGACTGCCGG - Intergenic
1202830467 14_GL000009v2_random:23325-23347 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1123704227 15:22939608-22939630 ACATTTCTGCAGATGACTGTAGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1131989522 15:98079874-98079896 ACTGAGCTGCAGATGCCTGCAGG + Intergenic
1135921718 16:26655733-26655755 ATTATTCTTTAGATGACTGCAGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136967283 16:34929272-34929294 ATTTAGCTCCAAATGACTGATGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146250452 17:31337179-31337201 ATTTATCTACAAATTAGTGCTGG - Intronic
1147547065 17:41409861-41409883 AATTGGCTGCAGATGACTTCAGG - Intergenic
1147556038 17:41479704-41479726 AATTGGCTGCAGATGACTTCAGG - Exonic
1148321190 17:46754741-46754763 ATTCATCTGGAGATGATTTCAGG + Intronic
1150473796 17:65459186-65459208 ATTTTTCTGCAAATGGCTGTAGG + Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153362320 18:4211213-4211235 ATGAATCTGCAGATGGCTGGGGG + Intronic
1153460127 18:5323999-5324021 ATTGATCTTCAGATCACTACTGG - Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1158828169 18:61247662-61247684 AGTTTTGTGCTGATGACTGCGGG + Intergenic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159509388 18:69376994-69377016 ATTTACATTCAGATTACTGCTGG + Intergenic
1159511985 18:69406538-69406560 ATAGATTTACAGATGACTGCTGG + Intronic
1159550656 18:69892699-69892721 ACTTGTCTGAAGATGAATGCAGG + Intronic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160352887 18:78200161-78200183 ATTCACCTGCACATCACTGCTGG - Intergenic
1160617680 18:80145570-80145592 ATGAATTTGCAGATCACTGCAGG - Intronic
1161673752 19:5630188-5630210 ATTTATCTGCATTTTTCTGCAGG + Intronic
1168016520 19:53578013-53578035 TTTGAACTGCAGTTGACTGCAGG - Exonic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1202642226 1_KI270706v1_random:104454-104476 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
926382418 2:12303664-12303686 ATGGAACTGCACATGACTGCGGG - Intergenic
926992181 2:18691877-18691899 ATTTATCTGATGATTACTGATGG - Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
928052169 2:28010404-28010426 ATTTTTCTGCAGATAAATGTAGG + Intronic
928841001 2:35604588-35604610 ATTGGCCTGCAGATCACTGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936077750 2:109412437-109412459 ATTTATCTGAACAGGACAGCAGG + Intronic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
938278281 2:130047466-130047488 TTTTATCTGGAGATGACTCCAGG + Intergenic
938329252 2:130438271-130438293 TTTTATCTGGAGATGACTCCAGG + Intergenic
938360694 2:130683222-130683244 TTTTATCTGGAGATGACTCCAGG - Intergenic
938437096 2:131289920-131289942 TTTTATCTGGAGATGACTCCAGG - Intronic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939413816 2:141866232-141866254 TTTTCTCTGCAGATGACTTAAGG - Intronic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941708421 2:168685317-168685339 ATTCAGCTGCAGATGCCTACTGG + Intronic
941746192 2:169089198-169089220 ATTTCTCTTCAGAGGACTGAAGG + Intronic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
942991246 2:182205939-182205961 ATTTATCCAAAGATGACTGGAGG - Exonic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946705445 2:222454197-222454219 CTTTATCTTCAGATGCTTGCAGG - Intronic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1173643881 20:44621825-44621847 ATATCTGTGCAGATGACTCCTGG + Intronic
1175601530 20:60277877-60277899 AGTTATCTCCAGAGGACTGCTGG - Intergenic
1176609653 21:8868163-8868185 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178105149 21:29310142-29310164 AATTATCTGCTGATGACTGTAGG + Intronic
1178678378 21:34650183-34650205 ATTTCTCTTGAGAGGACTGCAGG - Intergenic
1180359708 22:11877395-11877417 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180988423 22:19919031-19919053 ATTTATGTTCAGGTGACTGCTGG + Intronic
1181997325 22:26893052-26893074 ATTTAGCTGCAGATGTGGGCAGG - Intergenic
1182391727 22:30002977-30002999 ACTTACCTGTAGATGACGGCAGG - Exonic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949233740 3:1783313-1783335 GTTTACCTGCAGATGAGAGCTGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949905871 3:8858028-8858050 AGTTATCTGCAAATGACAGCAGG - Intronic
950211695 3:11127992-11128014 AAGTCTCTGGAGATGACTGCTGG + Intergenic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951145455 3:19221067-19221089 ACTTATCTTCATATGGCTGCAGG + Intronic
951291521 3:20876775-20876797 AGTTATCTGCACAAGACAGCAGG + Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953888225 3:46731733-46731755 ATGTATCTGCACAGGAGTGCTGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958482389 3:94659708-94659730 ATATATCTTCAGATGCCTCCTGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959260321 3:104071141-104071163 ATTAAATTGCAGATGACTGATGG - Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
961462352 3:127059382-127059404 ATTTATGTACAGATGGTTGCAGG + Intergenic
962829394 3:139126715-139126737 GGATATCTGCAGAGGACTGCTGG - Intronic
963615532 3:147532339-147532361 ATATATCTGCAGAGGTCTGCAGG + Intergenic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
963923436 3:150926862-150926884 ATTGATCTGCAGCTGACTAAAGG - Intronic
964297669 3:155251891-155251913 AGTTATCTGCAGATGATGGGAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
966865856 3:184258946-184258968 ATTTATCCACAGGAGACTGCAGG + Intronic
967545541 3:190722405-190722427 ATTTATCTGTACAAGACTGAGGG - Intergenic
1202736335 3_GL000221v1_random:2932-2954 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
970529662 4:16968784-16968806 ATTTATCTACATTTGACTTCTGG - Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971137735 4:23888318-23888340 GTTTATTTGAAAATGACTGCAGG + Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973819012 4:54646135-54646157 ACTTATTTTCTGATGACTGCTGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975719026 4:77232533-77232555 ATGTGTCTGCAGCTGACCGCTGG + Intronic
975724282 4:77276996-77277018 GTTCATCTGCAGGTGAATGCAGG - Intronic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978016558 4:103752953-103752975 ATGTATCTGCAAATGAATGGGGG - Intergenic
978640502 4:110865780-110865802 ATTAATGTGCAGAAGAATGCTGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978899080 4:113926848-113926870 TGTTATCTGCAGAAGACGGCAGG + Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980435640 4:132768849-132768871 TTTTAACTGCAGTTGACTGCAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982643379 4:157990715-157990737 ACTTATATGCAGGAGACTGCTGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1202769598 4_GL000008v2_random:190334-190356 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991114890 5:62943401-62943423 AGTTATCTGCAGAGTTCTGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993203391 5:84847511-84847533 AGTTATCTGCAGAAGACAGCAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994539518 5:101076899-101076921 ATTTAATTGCAGATGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995348782 5:111151357-111151379 TTTTAACTGCAGATTACTGTTGG + Intergenic
995461299 5:112406048-112406070 ATTTATCTTCAAATAACTGCTGG + Intronic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997645415 5:135478260-135478282 ACTTGTCTGCAGATGACTTCTGG + Intergenic
998608314 5:143660144-143660166 AGTTATATGCAAATGACTGATGG - Intergenic
998929098 5:147160704-147160726 ATTTTTCTGGAGATCCCTGCTGG + Intergenic
999325926 5:150643485-150643507 ATGTATCTGCAAATCTCTGCAGG + Intronic
999681032 5:154060270-154060292 TTTTAGCTGCAGATGACTTTAGG - Intronic
1000395132 5:160766849-160766871 ATTTTGCTACAGATGACTGTGGG + Intronic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003243841 6:4367838-4367860 CTTTATCTGCTGTTGACTTCTGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005634812 6:27743424-27743446 ATTTCTCTGCAGAAAAGTGCTGG + Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007844655 6:44743160-44743182 ATTTATATGAAGATGATTGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009552533 6:65117515-65117537 ATTTATGTTCAATTGACTGCGGG - Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010108012 6:72190934-72190956 AGTTATCTGCAGAAGACAGCAGG + Intronic
1010562032 6:77362517-77362539 CTCTATCTGCAGATGACTCCAGG - Intergenic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011115070 6:83880885-83880907 ACTTATTTGCAGATGACTGTAGG - Intronic
1011512641 6:88118033-88118055 ATTTATCCTCAGATGATTGGGGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014343083 6:120232902-120232924 ATTTCTCTGTAGAGGATTGCTGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014857560 6:126420589-126420611 AATTATCTGCAGATATTTGCTGG + Intergenic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1016792625 6:148081319-148081341 GTTGCTCTGCAAATGACTGCTGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019543589 7:1562204-1562226 AATGATGTGCAGATGACTGAGGG - Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1022184532 7:27954348-27954370 GTTCCTCTGCAGATGACGGCAGG - Intronic
1022562814 7:31367399-31367421 CTTTAACTACAGATGATTGCTGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1025223013 7:57132323-57132345 ATAAATCTGCAGATACCTGCAGG + Exonic
1025633810 7:63303987-63304009 ATAAATCTGCAGATACCTGCAGG + Intergenic
1025648886 7:63444181-63444203 ATAAATCTGCAGATACCTGCAGG - Intergenic
1025715989 7:63956101-63956123 ATTTATCTCCCTTTGACTGCAGG + Intergenic
1027026052 7:74852309-74852331 ATTGAGCTGGAGAAGACTGCAGG - Intergenic
1027061704 7:75091801-75091823 ATTGAGCTGGAGAAGACTGCAGG + Intergenic
1028231319 7:88309588-88309610 TTTTATATGCAGAAGGCTGCTGG + Intergenic
1028277027 7:88869906-88869928 ATTTATCTGCAGCTGACCTCTGG - Intronic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029844069 7:103395056-103395078 ATGCATCTGCAGATGTCTGCAGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1031305684 7:120123461-120123483 ATTTAGCTTCAGCTGACTTCAGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032256509 7:130301556-130301578 AGTTGTCTGCAGATGAATGAAGG - Intronic
1032303720 7:130713291-130713313 ATTGATGTGCAGAAGAATGCTGG - Intergenic
1032693463 7:134312804-134312826 ATTTATTTGCCGTTGACCGCTGG - Intronic
1032742791 7:134755904-134755926 ATCTATCTGGAAATGACTGGTGG + Intronic
1033334581 7:140441493-140441515 ATTCATGTGCAGATAAATGCAGG - Intergenic
1036991406 8:13600533-13600555 ATTTGGGTGAAGATGACTGCTGG - Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038302047 8:26361089-26361111 ATTTATCTGCAGATGATTTGCGG + Exonic
1040030987 8:42823460-42823482 ATTTATCTGTGGATGATGGCAGG + Intergenic
1041668050 8:60465190-60465212 AATCAGCTGCAAATGACTGCAGG + Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1047482405 8:125297258-125297280 ATTATCCTGGAGATGACTGCTGG - Intronic
1049933594 9:479425-479447 ATTTATGTGGAGATGTCTGTAGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050735769 9:8761058-8761080 ATGTGTCAGCAGATGACTGTGGG + Intronic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1055287279 9:74742181-74742203 ATTTCTCTTCAGATGCCTGTTGG + Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058412059 9:104744602-104744624 ATTTATTTGTAGATGTCTCCTGG - Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1203694491 Un_GL000214v1:84061-84083 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
1203705064 Un_KI270742v1:33371-33393 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1203558945 Un_KI270744v1:32440-32462 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
1203641782 Un_KI270751v1:20002-20024 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186550960 X:10504989-10505011 CTTTATATTCAGAGGACTGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1187747807 X:22428810-22428832 ATTTCTGTGCACATGACTCCTGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191916300 X:66205359-66205381 ATTTCTCAGCAAATGAATGCAGG - Intronic
1191932924 X:66394130-66394152 AGTTATCTGCAGAAGACAGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193356253 X:80523093-80523115 AGTTATCTGCAGAAGACAGTAGG - Intergenic
1193599409 X:83490934-83490956 ATATATGTGCAAATGACAGCAGG + Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194768704 X:97873940-97873962 ATTTTTGTGCAGATGAAAGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196596705 X:117554229-117554251 CTTCATCTTCAGCTGACTGCAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic