ID: 913531106

View in Genome Browser
Species Human (GRCh38)
Location 1:119734961-119734983
Sequence GGTCTAGGTAAGCTGGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913531095_913531106 22 Left 913531095 1:119734916-119734938 CCCCTACGTTGGATAGGGGAGGG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 913531106 1:119734961-119734983 GGTCTAGGTAAGCTGGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 114
913531097_913531106 21 Left 913531097 1:119734917-119734939 CCCTACGTTGGATAGGGGAGGGT 0: 1
1: 0
2: 0
3: 2
4: 60
Right 913531106 1:119734961-119734983 GGTCTAGGTAAGCTGGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 114
913531102_913531106 -5 Left 913531102 1:119734943-119734965 CCAGCTAGAAGTGCTTGGGGTCT 0: 1
1: 0
2: 0
3: 6
4: 85
Right 913531106 1:119734961-119734983 GGTCTAGGTAAGCTGGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 114
913531098_913531106 20 Left 913531098 1:119734918-119734940 CCTACGTTGGATAGGGGAGGGTG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 913531106 1:119734961-119734983 GGTCTAGGTAAGCTGGGCACAGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913531106 Original CRISPR GGTCTAGGTAAGCTGGGCAC AGG Intronic
902395925 1:16132525-16132547 GGTGTAGGAGAGGTGGGCACAGG + Intronic
905480055 1:38255622-38255644 GGTCTAAGTCAGCAGAGCACTGG + Intergenic
906671255 1:47656736-47656758 GGTCCAAGTGACCTGGGCACTGG - Intergenic
913531106 1:119734961-119734983 GGTCTAGGTAAGCTGGGCACAGG + Intronic
915672950 1:157505477-157505499 GATCTAGGGAAGGTGGGCTCAGG + Intergenic
917683306 1:177390387-177390409 GGTATAGGTAACCTGAGCTCTGG - Intergenic
1067032326 10:42886086-42886108 GGTCTCGCAGAGCTGGGCACTGG - Intergenic
1068263900 10:54622342-54622364 GTTCTAGGGAAGCTGAGCGCTGG + Intronic
1070654464 10:78261931-78261953 GGCCTAGGTGAGCTTGGCAGTGG + Intergenic
1075406496 10:122199125-122199147 GGTATAGGCACGCAGGGCACAGG - Intronic
1075538189 10:123289137-123289159 GGTCCAGCTAAGCTGTGCCCAGG - Intergenic
1076803700 10:132844762-132844784 GCTGTGGGTGAGCTGGGCACGGG - Intronic
1076919583 10:133444771-133444793 GGTCTAGGTGAGGAGGGCAGAGG - Intergenic
1077659782 11:4057338-4057360 GGTCCAGCCAGGCTGGGCACAGG + Intronic
1080529512 11:33161420-33161442 GGTCTGGCTCAGCTGGGCAGGGG - Exonic
1081583702 11:44369922-44369944 GGGCAAGGTAAGCAGGGCAATGG - Intergenic
1081782022 11:45719649-45719671 GGCCTGGGTAAGGAGGGCACAGG - Intergenic
1081941666 11:46947968-46947990 GGTCTTTGTAAGTTGGCCACAGG - Intronic
1089559089 11:119334680-119334702 GGTCGATGTAAGCTGGGCGCAGG - Exonic
1090078658 11:123595580-123595602 CATCTAGTTAGGCTGGGCACAGG - Intronic
1096803461 12:54126606-54126628 GGAGCAGGTAAGCTGGGCCCGGG + Intergenic
1101762486 12:107670192-107670214 GGTCAAGCTCAGCTGGGCACTGG + Intergenic
1104047636 12:125174319-125174341 GGGCCAGGTATGCTGGGGACAGG - Intergenic
1106794269 13:33188171-33188193 CTTCTAGGTCACCTGGGCACTGG - Intronic
1113072034 13:106431411-106431433 GGTGATGGTGAGCTGGGCACAGG + Intergenic
1115084235 14:29494164-29494186 TGGCTAGGTAAGCTGGTTACTGG - Intergenic
1115524528 14:34266486-34266508 TGTCCAGGGAAGCAGGGCACAGG + Intronic
1118811019 14:69273762-69273784 GGTGTAGGTGAGCTTGGCTCTGG + Intronic
1119304373 14:73595492-73595514 TGTGAAGGGAAGCTGGGCACAGG - Exonic
1119856885 14:77907754-77907776 GGTCTGGGGAAGCTGGGAATCGG - Intronic
1122097922 14:99384828-99384850 GGGTTATGTAAGCTGTGCACTGG - Intergenic
1122652494 14:103233069-103233091 GCTCTGGGCAGGCTGGGCACAGG - Intergenic
1122793381 14:104193726-104193748 TGTCCAGGTGACCTGGGCACAGG + Intergenic
1129362627 15:75033869-75033891 GGTCTAGGGAGGCTCTGCACAGG - Intronic
1136891929 16:33976898-33976920 GCTCTTGCTAAGCTGGGCCCGGG - Intergenic
1137563934 16:49521783-49521805 GGGCTAGGTAGGCTGAGCTCAGG - Intronic
1138530810 16:57633460-57633482 GGTCTGGGACAGCTGGGGACAGG - Intronic
1203081107 16_KI270728v1_random:1146710-1146732 GCTCTTGCTAAGCTGGGCCCGGG + Intergenic
1142973642 17:3630189-3630211 GGCCAAGGTATGCTGGGCTCGGG - Exonic
1142981926 17:3677386-3677408 AGTCTAGGTAAGATGGGGAAGGG - Intronic
1143023965 17:3930193-3930215 GGTCCAGGTGGGCTGGGCGCAGG - Intronic
1143037311 17:4006778-4006800 GCTCAAGGAGAGCTGGGCACTGG + Exonic
1146754025 17:35410136-35410158 GGTATGGGTGACCTGGGCACAGG - Intergenic
1150362335 17:64547565-64547587 GGTGCAGGCAAGCTGGGCAGCGG - Intronic
1150654593 17:67031620-67031642 GGTCGAGGGAAGCTGGCCCCGGG - Exonic
1151311082 17:73292784-73292806 GCTCTATGTAACCTGGGCCCTGG - Intronic
1152353109 17:79794264-79794286 GCTCTAGGGAAGTTGGGCCCTGG - Exonic
1152681779 17:81672149-81672171 GGACCAGGTAAGTGGGGCACGGG + Exonic
1153507756 18:5819885-5819907 GCTCCTGGTAAGCTGGACACGGG - Intergenic
1156100379 18:33586672-33586694 GGGCTAGGCAAGCTGGCCAAGGG - Intronic
1156100612 18:33590183-33590205 GGACAAGGTAAGATGGCCACTGG + Intronic
1157501820 18:48196144-48196166 GGTCTGGATAAGGAGGGCACTGG - Intronic
1160683234 19:422130-422152 GGGCGTGGTAAGCTGTGCACAGG - Exonic
1161149786 19:2701874-2701896 GGTCGAGGTTAGCTGGGGAGGGG - Intronic
1161149880 19:2702219-2702241 GGTCCAGGTTAGCTGGGGAGGGG - Intronic
1161149914 19:2702342-2702364 GGTCGAGGTTAGCTGGGGACGGG - Intronic
1161425054 19:4198596-4198618 GGTCCAGGTCAGCCGGGGACGGG - Intronic
1162960904 19:14126008-14126030 GTTCAAGTTCAGCTGGGCACGGG - Intronic
1163110687 19:15159596-15159618 TGTCTAGGTAAGGTGGGGAGTGG - Exonic
1165533430 19:36422626-36422648 TGTGAAGGGAAGCTGGGCACAGG - Intergenic
927515535 2:23669729-23669751 GCTCTAAATGAGCTGGGCACCGG - Intronic
927814180 2:26199661-26199683 GGTCTAGGTAGGCCTGGAACTGG - Intronic
928669050 2:33581481-33581503 GATGGAGGTAATCTGGGCACTGG + Intergenic
929450094 2:42030995-42031017 GCTCTGGGTCTGCTGGGCACTGG - Intergenic
932731797 2:74226941-74226963 GGTCATGGTAAAGTGGGCACGGG - Exonic
933023691 2:77226272-77226294 GCTCTGGGTAAGATGAGCACAGG + Intronic
939387080 2:141514543-141514565 GGTAGATATAAGCTGGGCACAGG + Intronic
940007031 2:149017233-149017255 GGTATAGCTGAGCTGGGCAGAGG + Intronic
940129389 2:150363671-150363693 GGACAAGGTAAGATGGTCACGGG - Intergenic
942215332 2:173713698-173713720 GGCCTAGGAGAGCAGGGCACTGG - Intergenic
942958077 2:181797587-181797609 GGTCTGGGTACGCAGGGGACAGG + Intergenic
946429161 2:219615424-219615446 GGTCTAGGAACCCTGGGCATTGG + Intronic
1170004130 20:11646978-11647000 GGTTGAGGTCAGCTTGGCACTGG + Intergenic
1170817251 20:19724210-19724232 GGCCAAGGGAAGATGGGCACTGG + Intergenic
1172164249 20:32889290-32889312 GGTCTGGTTAAGCTGGCCAGAGG - Exonic
1172958272 20:38777995-38778017 AGGCTACTTAAGCTGGGCACTGG - Intergenic
1175921146 20:62451138-62451160 GCTCTAGGTCAGCTGGGCTCAGG - Intergenic
1176001231 20:62832183-62832205 AGACCAGGTGAGCTGGGCACAGG + Exonic
1177547908 21:22582704-22582726 TGTCTTGGTAATCTGAGCACAGG + Intergenic
1179361936 21:40717960-40717982 AGTCTAGGCCAGCTGGGCATTGG + Intronic
1180929287 22:19577892-19577914 GGTCTGGGTCAGTTGGGAACTGG + Intergenic
1181049268 22:20231040-20231062 GGCCTGGGGAAGCTGGGCCCAGG - Intergenic
1184345209 22:43908939-43908961 GGCCCAGGTAGGCTGGGCATCGG - Intergenic
1184514371 22:44952953-44952975 GAGCTAGGTCAGCAGGGCACAGG - Intronic
1185282799 22:49982931-49982953 GGCCTAGGGGAGCTGGGGACGGG + Intergenic
1185375660 22:50481706-50481728 GGGCGTGGCAAGCTGGGCACGGG - Exonic
951253020 3:20416240-20416262 TCTCTAGGTAACCTGGGCATTGG - Intergenic
951669247 3:25161940-25161962 GGTCTCTGTACCCTGGGCACAGG - Intergenic
953742225 3:45547709-45547731 GGTGAAGGTGAGCTGGGCAAAGG + Exonic
954549067 3:51465126-51465148 GGTCTAGCTAAACTGGGGTCTGG + Intronic
956975691 3:74575945-74575967 GAGCTAGGGAAGCTGGACACTGG - Intergenic
959575491 3:107928399-107928421 GGTCTTGGTGAGATGGACACGGG + Intergenic
961486642 3:127221705-127221727 GGACTAGGTAAGCTTGTCAGGGG + Intergenic
966745415 3:183270530-183270552 AGTCAGGGTAAGCTGGCCACTGG - Exonic
976608771 4:87007418-87007440 AGTCAAGGTAAGCCGTGCACCGG + Intronic
977879737 4:102190230-102190252 AGTCTAGGGAAATTGGGCACTGG - Intergenic
981562148 4:146059630-146059652 GGTCTGGGTAAGCTGGACCAGGG - Intergenic
985613847 5:907609-907631 GGACCAGGCACGCTGGGCACAGG + Intronic
987191680 5:15484988-15485010 GGTCTGGGTACGCTGGGCCTGGG + Intergenic
995299515 5:110561757-110561779 AGTTTAGGTCAGCTGGGGACTGG + Intronic
1001701015 5:173706432-173706454 GGCCTGGGGAAGCTGGGCCCTGG - Intergenic
1002291957 5:178206004-178206026 GGAGAAGGTAAGCTGGGTACTGG + Exonic
1006084414 6:31586309-31586331 GCTCTGGGTAAGCTGGGAATGGG + Intronic
1014734091 6:125071284-125071306 GCTCAAAGTAAGCTGGGCAGTGG + Intronic
1015664640 6:135615351-135615373 GGTCTAGGACAGCTGAGCAAGGG - Intergenic
1018092423 6:160356517-160356539 GCTCCAGGGCAGCTGGGCACAGG + Intronic
1018769166 6:166956804-166956826 GGTCTAGGTTAGCTCGGACCCGG - Intronic
1024588157 7:50858725-50858747 GGACAAGGAAAGCTGGGCAGGGG + Intergenic
1027136462 7:75627843-75627865 GGTCAAGGGGAGCTGGGCACAGG + Intronic
1033717398 7:144017120-144017142 GGTATAAGTAAGCTGAGCCCTGG + Intergenic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1035529463 8:339274-339296 GCTCGAGGGAATCTGGGCACAGG + Intergenic
1043300682 8:78727172-78727194 GGTTTAATTAAGTTGGGCACTGG - Intronic
1061408617 9:130406168-130406190 GGTCTGGGTCTGCTGGGCATGGG + Intronic
1062043855 9:134416243-134416265 GGTGGAGGTAAGCTGGGGGCGGG + Intronic
1062536740 9:137024344-137024366 GGGCCAGGGAAGGTGGGCACAGG + Intronic
1191941796 X:66489218-66489240 GGCCTTGGTAGGGTGGGCACCGG - Intergenic
1196231491 X:113227888-113227910 GGTCTAGTGCAACTGGGCACTGG + Intergenic
1196483946 X:116182108-116182130 GGGCTTGGGAAGCTGAGCACAGG + Intergenic
1196825069 X:119734469-119734491 GTTCTAGGTCTGCTGGTCACTGG - Intergenic