ID: 913532579

View in Genome Browser
Species Human (GRCh38)
Location 1:119743210-119743232
Sequence GTGGATACTCAGTTCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913532575_913532579 0 Left 913532575 1:119743187-119743209 CCAGTTTTCAGAACCTTCAGGGA 0: 1
1: 0
2: 2
3: 18
4: 211
Right 913532579 1:119743210-119743232 GTGGATACTCAGTTCAAAGAGGG 0: 1
1: 0
2: 0
3: 14
4: 160
913532572_913532579 19 Left 913532572 1:119743168-119743190 CCATACAGAGGGTCTGATGCCAG 0: 1
1: 0
2: 0
3: 15
4: 118
Right 913532579 1:119743210-119743232 GTGGATACTCAGTTCAAAGAGGG 0: 1
1: 0
2: 0
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913532579 Original CRISPR GTGGATACTCAGTTCAAAGA GGG Intronic
900819072 1:4872381-4872403 GTGAATTCTCAGTTCTAAGAGGG - Intergenic
901874190 1:12157445-12157467 GTGAATAGGCAGTTCACAGAAGG + Intergenic
902198869 1:14819067-14819089 GAAGATACTCAGTACCAAGAAGG + Intronic
902607532 1:17576917-17576939 GTGGAAACTGAGTCCAAAGGAGG - Intronic
905895651 1:41544421-41544443 GTGTTTAATCAATTCAAAGAGGG - Intronic
907544897 1:55251237-55251259 GTGGAAACTGAATTAAAAGAAGG - Intergenic
907867080 1:58408779-58408801 GTGGAGACTCAGTTCCCACAGGG + Intronic
908806860 1:67940638-67940660 GAGGAAACTGAGCTCAAAGATGG + Intergenic
911775735 1:101809647-101809669 ATGGAAACACAGTTCCAAGAGGG + Intronic
913532579 1:119743210-119743232 GTGGATACTCAGTTCAAAGAGGG + Intronic
914242375 1:145860284-145860306 GTGGGTAGGCAGTTCAGAGAGGG - Intergenic
917509715 1:175660112-175660134 GTGGAAACTGAGTCCAGAGAGGG - Intronic
917595096 1:176521334-176521356 GTGGTTGCTGAGTTCCAAGAAGG - Intronic
920662017 1:207923189-207923211 GTGGACACTCAGCTCACAGCTGG + Intergenic
920790600 1:209086536-209086558 GAGGATAATTAGTCCAAAGAAGG + Intergenic
923897537 1:238288752-238288774 GCTGATACTCAGTTCAGTGAGGG - Intergenic
924072740 1:240298639-240298661 GTGCATACGCAGTTCACAAAAGG - Intronic
1064486283 10:15794381-15794403 GTGTATAGTCAGCTCTAAGAAGG - Intronic
1065709421 10:28501227-28501249 TTGGATACTCATTTCATAAATGG - Intergenic
1065892826 10:30135614-30135636 GTGGCTACAGAGTTCAAACAGGG + Intergenic
1067770753 10:49121998-49122020 GTGGGAACTCAGTTGACAGAGGG - Intergenic
1070278320 10:75029391-75029413 GTCGATACAGAGTTCAAAGAGGG + Exonic
1070289806 10:75106768-75106790 GTGGATACTCAGTAAATAGCTGG + Intronic
1075663909 10:124217351-124217373 TTGGATTCTCATTTCACAGAAGG - Intergenic
1075941639 10:126395153-126395175 GTGGCTACAGAGTTCCAAGAAGG + Intergenic
1077591022 11:3491156-3491178 GTGGCGACTCACTTCAAAGTGGG + Intergenic
1081962864 11:47151124-47151146 ATGGATACTCAATTAGAAGAAGG + Intronic
1083007877 11:59365705-59365727 GTGGCTTCTCAGATCAAAGATGG + Intergenic
1084970866 11:72771398-72771420 GGGAATACTGAGTCCAAAGATGG - Intronic
1089464221 11:118673827-118673849 GTTGTTACTCTGATCAAAGAAGG - Intronic
1089906604 11:122046475-122046497 ATTGATGCTCAGGTCAAAGATGG + Intergenic
1093738839 12:22657422-22657444 GAGAATACTGAGTTCAAACATGG + Intronic
1095905644 12:47374979-47375001 GTTGTTTCTCAGTTCTAAGAGGG - Intergenic
1096177580 12:49533148-49533170 CTTGATACTCAGTTCCAAGGAGG + Intergenic
1099066718 12:77989946-77989968 TTGGATACTCATTTTAAAAAAGG - Intronic
1099223966 12:79946563-79946585 GTGGAGAATCATTTCAAAAATGG - Intergenic
1099724004 12:86400592-86400614 ATGAAAGCTCAGTTCAAAGATGG - Intronic
1100793005 12:98151305-98151327 GTGGTTAGTCAGTTCTCAGAAGG + Intergenic
1100888167 12:99095444-99095466 GTGGCTAAACAGTTCAGAGAAGG + Intronic
1102627972 12:114251504-114251526 GTGGACACTCAGTAAATAGAGGG - Intergenic
1105340255 13:19516709-19516731 GTGAATGCTCTGTTCAAGGATGG - Intronic
1107692787 13:42968667-42968689 GTGGAGAGTCAGTTCCAAGAGGG - Intronic
1112314898 13:98352010-98352032 ATGGATATGCAGTTCTAAGAAGG + Intronic
1112952336 13:105015564-105015586 GTGGAAACTCAGGTGCAAGAGGG + Intergenic
1113036167 13:106052313-106052335 ATGGGTATTCAGTTCAAAGCTGG - Intergenic
1114587635 14:23828611-23828633 ATGAATACTTAGCTCAAAGAGGG - Intergenic
1116756430 14:48954513-48954535 GTAGATAGTAAGTTCAGAGAAGG - Intergenic
1118923231 14:70168673-70168695 GTGGAGACTCCGTTGAAAAATGG + Intronic
1126846370 15:52764447-52764469 GGGGACACTAAGCTCAAAGAAGG + Intronic
1130349482 15:83078605-83078627 GTGAATTCTCAGTTGAAAAAAGG - Intergenic
1131177199 15:90217547-90217569 GTTGCTACTGAGTGCAAAGAGGG - Exonic
1134792441 16:17001488-17001510 CTGGCTTCTCACTTCAAAGAAGG + Intergenic
1137624793 16:49900766-49900788 CCGGATACTCATTTCAAAGGTGG + Intergenic
1139869804 16:70097827-70097849 GTGTATACTCAGTTTATAGCAGG + Intergenic
1140385637 16:74534726-74534748 GTGTATACTCAGTTTATAGCAGG - Intronic
1146547285 17:33750004-33750026 GTGGATATTTAGATCAAAGAGGG - Intronic
1148214821 17:45828775-45828797 GTGGTGACTCAGTTCAGAAATGG + Intronic
1150518394 17:65838493-65838515 CAGGAAAATCAGTTCAAAGAGGG + Intronic
1161453167 19:4357781-4357803 TTGGCTGCTCAGTACAAAGAGGG + Intronic
1162183412 19:8886336-8886358 GTGGTTATTCTGATCAAAGATGG - Intronic
1163918670 19:20266666-20266688 ATGAATACATAGTTCAAAGAGGG + Intergenic
1163930333 19:20384267-20384289 ATGAATACATAGTTCAAAGAGGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
930862034 2:56084493-56084515 TTGGATACTGACTTCATAGATGG + Intergenic
932073133 2:68640945-68640967 GTGGATACTCATTTCAGGAAGGG + Intergenic
936748230 2:115607177-115607199 TTGGATACTGATGTCAAAGAAGG + Intronic
936934860 2:117829452-117829474 AAGGATACTCAGATCAACGAAGG - Exonic
942051336 2:172143785-172143807 TTGGCTACTCAGTTGAAAAAGGG + Intergenic
946498530 2:220220688-220220710 GTTGAAACTCTGTTCAAATAAGG - Intergenic
946788710 2:223276265-223276287 GTGGAGTGACAGTTCAAAGAGGG - Intergenic
947957554 2:234206545-234206567 GAGGATTCTAAGTTCCAAGAGGG + Intergenic
948344555 2:237284459-237284481 TAGGATATTCAGTTCATAGATGG - Intergenic
948764928 2:240214668-240214690 GTGGACACACAGCTCAAAGCGGG + Intergenic
1169072614 20:2742638-2742660 GGGGATCCTCAGGTCAGAGAGGG + Intronic
1169311726 20:4548237-4548259 GGGGATACTCATTACAAAGCTGG + Intergenic
1176081222 20:63274012-63274034 GTGGATGCTCAGTTTGATGACGG + Intronic
1176733952 21:10525051-10525073 TTGGATGCTCTGTTCAAGGATGG + Intronic
1178849817 21:36203797-36203819 GTGGATAATAAGTTCTAACAGGG - Intronic
1179489223 21:41729447-41729469 GTGGATACACCCTTCAAACACGG - Intergenic
1180561702 22:16620523-16620545 GTGGATTCTCTGTTCAAGGATGG + Intergenic
1183101406 22:35586268-35586290 GAGGAAACTGAGGTCAAAGAGGG + Intergenic
1184469918 22:44690571-44690593 GAGGATTCTCATTTCACAGATGG + Intronic
1184971678 22:48026780-48026802 ATGTATGCTCAGTTTAAAGATGG - Intergenic
952212506 3:31242388-31242410 GTAGCTAGTCAGCTCAAAGAAGG + Intergenic
952483824 3:33789384-33789406 GAGGATACTAACTTCAGAGAGGG + Intergenic
952840746 3:37643250-37643272 GTAAATACTCTTTTCAAAGAGGG + Intronic
956381774 3:68671774-68671796 GAGGAAAATCATTTCAAAGACGG + Intergenic
957089057 3:75710151-75710173 ATGGATACACAGTTTAAAAAGGG + Intronic
959448106 3:106465730-106465752 GTCAATATTCAGTTAAAAGAAGG - Intergenic
959731306 3:109605645-109605667 CTGGTTAATCAGTTCAATGAAGG + Intergenic
964662104 3:159131523-159131545 CTGGAGACTGAGTTCAAGGAGGG - Intronic
964710030 3:159662044-159662066 GGGGTGACTCAGGTCAAAGAAGG - Intronic
964866621 3:161269519-161269541 GAGGAAACTGAGTTAAAAGAAGG - Intergenic
965459279 3:168941714-168941736 GTGGATACAGAATTCAAAGTTGG - Intergenic
966040382 3:175478291-175478313 GTGGTAACTCAGTGTAAAGAAGG - Intronic
966847864 3:184144501-184144523 GAGGCTACTCAGTGCATAGAGGG + Intronic
968525275 4:1053779-1053801 GGGGATAGTCAGCTCATAGAGGG + Intergenic
968525295 4:1053859-1053881 GGGGATAGTCAGCTCATAGAGGG + Intergenic
968525460 4:1054572-1054594 GGGGATAGTCAGCTCATAGAGGG + Intergenic
971035679 4:22690139-22690161 GTGGAAAGTGAGTTCAAGGAGGG + Intergenic
971088461 4:23309502-23309524 GGGGATACTCACTTGAAAGAGGG - Intergenic
976229716 4:82829010-82829032 TTGGGTACTCTGTTCAAAGCTGG + Exonic
976385248 4:84449424-84449446 GTGGACAGTAAGTTCAAGGAGGG - Intergenic
977829656 4:101576067-101576089 GTGGATGGTCTGTTCCAAGATGG + Intronic
978542722 4:109836290-109836312 TGTGATTCTCAGTTCAAAGACGG + Intronic
979690822 4:123556361-123556383 GTGGAATCTCACTTCAAAGAAGG + Intergenic
981838245 4:149080482-149080504 GTGGACACTCAGTCCAAATTTGG - Intergenic
983463631 4:168058185-168058207 CTGGAGACTTAGTTCTAAGAGGG - Intergenic
983472837 4:168177429-168177451 GTGGATACTCAGTTTGATAAGGG + Intronic
986460362 5:7964058-7964080 GTGGATAATGATTTCAAACATGG + Intergenic
987699070 5:21371747-21371769 ATGGACATTCAGTCCAAAGATGG - Intergenic
988753584 5:34219730-34219752 ATGGACATTCAGTCCAAAGATGG + Intergenic
990266678 5:54084275-54084297 GCGGATTCTCAGTCCACAGATGG + Intronic
990772733 5:59268020-59268042 GTGGATGCTTAGTTCAAACTGGG + Intronic
991741368 5:69680580-69680602 ATGGACATTCAGTCCAAAGATGG + Intergenic
991756250 5:69873861-69873883 ATGGACATTCAGTCCAAAGATGG - Intergenic
991792942 5:70260317-70260339 ATGGACATTCAGTCCAAAGATGG + Intergenic
991820827 5:70556654-70556676 ATGGACATTCAGTCCAAAGATGG + Intergenic
991835653 5:70749775-70749797 ATGGACATTCAGTCCAAAGATGG - Intergenic
991885391 5:71260625-71260647 ATGGACATTCAGTCCAAAGATGG + Intergenic
992346736 5:75886666-75886688 GTTGTTACTGAGTTAAAAGAAGG - Intergenic
992546301 5:77817293-77817315 GTGGATAGTCAGGTCAACGAAGG - Intronic
998215720 5:140237483-140237505 GAGGATGCTGAGTTCAAAGAAGG - Intronic
999543347 5:152598753-152598775 GGGGACACCGAGTTCAAAGATGG + Intergenic
1005551752 6:26926551-26926573 ATGGACATTCAGTCCAAAGATGG + Intergenic
1005911285 6:30311901-30311923 GTGGGGGCTCAGTTCAAAGAAGG - Intergenic
1007938111 6:45751929-45751951 GAGGAAACTAAGGTCAAAGATGG + Intergenic
1010144316 6:72648858-72648880 GTGGAGACACATTCCAAAGAAGG + Intronic
1012611146 6:101222589-101222611 CTGGTTACTCAGTACAAAAATGG - Intergenic
1013264596 6:108483027-108483049 GTGGATATGTAGTTGAAAGAGGG - Intronic
1014157077 6:118123741-118123763 GTGGATATTCAGTTTAAGCAAGG - Intronic
1017224240 6:152001717-152001739 GTGGTTACTGACTTCAAAGGTGG + Intronic
1017715385 6:157207395-157207417 CTGGATACTGAGTTTACAGAGGG - Exonic
1017941224 6:159055060-159055082 GTGGTTCTTCAGTGCAAAGAGGG + Intergenic
1026183467 7:68062467-68062489 GTGAATACATAGCTCAAAGAAGG - Intergenic
1026206942 7:68265944-68265966 GGGGTGACTCAGGTCAAAGAAGG - Intergenic
1027809797 7:82881017-82881039 GTGGATTCTCAGTTCTGATATGG - Intronic
1029034889 7:97509084-97509106 GTGGCTACTCAAATGAAAGAAGG + Intergenic
1031456306 7:121984549-121984571 GTCAAGACTCAGTTCAAAGGCGG - Intronic
1032799456 7:135306639-135306661 GAGGATTCTCAGTTCAAACCTGG + Intergenic
1033377556 7:140777532-140777554 GAGGATATTTAGTTCACAGAAGG - Intronic
1034742070 7:153484516-153484538 GTGCATACCCAGATTAAAGATGG + Intergenic
1035140935 7:156760026-156760048 GGGGTGACTCAGGTCAAAGAAGG + Intronic
1041082887 8:54230220-54230242 TTTGATACTCATTTCAGAGAAGG + Intergenic
1042652051 8:71053694-71053716 GAGGTTATTCAGTTGAAAGATGG + Intergenic
1043359785 8:79458812-79458834 TTGAAGACTCAGTTCACAGAGGG - Intergenic
1045844503 8:106617443-106617465 GTGGGTGCTAAGTACAAAGAAGG + Intronic
1049338263 8:142098022-142098044 GTGGATAAGCAGGTCACAGATGG + Intergenic
1051861767 9:21633345-21633367 GTGTATACTCACTTAAAAGTAGG + Intergenic
1052757799 9:32558439-32558461 GTGGATATTAAATTCACAGATGG + Intronic
1053032617 9:34794270-34794292 ATGGAAACACAGTTCACAGAAGG + Intergenic
1056677861 9:88691541-88691563 GTGGCTACTCACTCCATAGACGG - Intergenic
1058798546 9:108521937-108521959 GAGCACACTCAGTTCAAGGATGG - Intergenic
1061648665 9:132027981-132028003 GTGGTTGCTCAGATCAGAGATGG - Intronic
1203488534 Un_GL000224v1:81811-81833 ATGGATACACAGTTTAAAAAGGG - Intergenic
1203501155 Un_KI270741v1:23707-23729 ATGGATACACAGTTTAAAAAGGG - Intergenic
1186147605 X:6641238-6641260 GTGCATTCTCATTTGAAAGATGG - Intergenic
1186214416 X:7283617-7283639 GTGGATTTTCAGTTCAATGCAGG + Intronic
1187817542 X:23249103-23249125 GTGGAGCCTCAGTAGAAAGAGGG - Intergenic
1189410049 X:40762009-40762031 GTAGATTCTCTGTTCAAGGAGGG + Intergenic
1190180878 X:48191340-48191362 GTGGAGACCGAATTCAAAGAAGG - Intronic
1190183399 X:48213721-48213743 GTGGAGACCAAATTCAAAGAAGG + Intronic
1190193920 X:48300808-48300830 GTGGAGACCGAATTCAAAGATGG - Intergenic
1190199804 X:48351207-48351229 GTGGAGACTGAATTCAAAGAAGG - Intronic
1190204103 X:48388244-48388266 GTGGAGACCAAATTCAAAGAAGG + Intronic
1190206433 X:48407159-48407181 GTGGAGACCAAATTCAAAGAAGG - Intronic
1190666582 X:52701688-52701710 GTGGAGACTGAATTCAAAGAAGG - Intronic
1190672836 X:52756720-52756742 GTGGAGACTGAATTCAAAGAAGG + Intronic
1191164258 X:57370770-57370792 CTGCATACTCAGTTCACAAAAGG - Intronic
1191938526 X:66452376-66452398 GTGGAATCTCAGTTAAAGGAGGG + Intergenic
1192848315 X:74927597-74927619 GAGGATACTAAGTTAAAATAAGG + Intergenic
1196824326 X:119729143-119729165 ATGAATACACAGTTCAAAGTGGG + Intergenic
1197645837 X:129015624-129015646 CTGGATAATCTGTTCAAAGTAGG - Intergenic
1200739174 Y:6834485-6834507 GTGGATACTCACTGAAAATAAGG + Intergenic
1202112848 Y:21442537-21442559 ATGGATTCTCAGTACAAACATGG + Intergenic