ID: 913532616

View in Genome Browser
Species Human (GRCh38)
Location 1:119743407-119743429
Sequence GGCCACCAGGGACAGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913532616_913532627 29 Left 913532616 1:119743407-119743429 CCCTGTGGCTGTCCCTGGTGGCC No data
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532616_913532625 21 Left 913532616 1:119743407-119743429 CCCTGTGGCTGTCCCTGGTGGCC No data
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532616_913532623 17 Left 913532616 1:119743407-119743429 CCCTGTGGCTGTCCCTGGTGGCC No data
Right 913532623 1:119743447-119743469 ACCTACAAAGCCTCCAGCCATGG 0: 1
1: 0
2: 1
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913532616 Original CRISPR GGCCACCAGGGACAGCCACA GGG (reversed) Intronic
No off target data available for this crispr