ID: 913532617

View in Genome Browser
Species Human (GRCh38)
Location 1:119743408-119743430
Sequence TGGCCACCAGGGACAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913532617_913532627 28 Left 913532617 1:119743408-119743430 CCTGTGGCTGTCCCTGGTGGCCA 0: 1
1: 0
2: 3
3: 29
4: 280
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532617_913532623 16 Left 913532617 1:119743408-119743430 CCTGTGGCTGTCCCTGGTGGCCA 0: 1
1: 0
2: 3
3: 29
4: 280
Right 913532623 1:119743447-119743469 ACCTACAAAGCCTCCAGCCATGG 0: 1
1: 0
2: 1
3: 20
4: 178
913532617_913532625 20 Left 913532617 1:119743408-119743430 CCTGTGGCTGTCCCTGGTGGCCA 0: 1
1: 0
2: 3
3: 29
4: 280
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913532617 Original CRISPR TGGCCACCAGGGACAGCCAC AGG (reversed) Intronic