ID: 913532618

View in Genome Browser
Species Human (GRCh38)
Location 1:119743419-119743441
Sequence TGCAGCTGGGCTGGCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 418}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913532618_913532627 17 Left 913532618 1:119743419-119743441 CCCTGGTGGCCAGCCCAGCTGCA 0: 1
1: 0
2: 1
3: 43
4: 418
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532618_913532625 9 Left 913532618 1:119743419-119743441 CCCTGGTGGCCAGCCCAGCTGCA 0: 1
1: 0
2: 1
3: 43
4: 418
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532618_913532623 5 Left 913532618 1:119743419-119743441 CCCTGGTGGCCAGCCCAGCTGCA 0: 1
1: 0
2: 1
3: 43
4: 418
Right 913532623 1:119743447-119743469 ACCTACAAAGCCTCCAGCCATGG 0: 1
1: 0
2: 1
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913532618 Original CRISPR TGCAGCTGGGCTGGCCACCA GGG (reversed) Intronic