ID: 913532619

View in Genome Browser
Species Human (GRCh38)
Location 1:119743420-119743442
Sequence CTGCAGCTGGGCTGGCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 420}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913532619_913532625 8 Left 913532619 1:119743420-119743442 CCTGGTGGCCAGCCCAGCTGCAG 0: 1
1: 0
2: 4
3: 55
4: 420
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532619_913532627 16 Left 913532619 1:119743420-119743442 CCTGGTGGCCAGCCCAGCTGCAG 0: 1
1: 0
2: 4
3: 55
4: 420
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532619_913532623 4 Left 913532619 1:119743420-119743442 CCTGGTGGCCAGCCCAGCTGCAG 0: 1
1: 0
2: 4
3: 55
4: 420
Right 913532623 1:119743447-119743469 ACCTACAAAGCCTCCAGCCATGG 0: 1
1: 0
2: 1
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913532619 Original CRISPR CTGCAGCTGGGCTGGCCACC AGG (reversed) Intronic