ID: 913532620

View in Genome Browser
Species Human (GRCh38)
Location 1:119743428-119743450
Sequence AGGTTTTGCTGCAGCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 312}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913532620_913532632 29 Left 913532620 1:119743428-119743450 CCAGCCCAGCTGCAGCAAAACCT 0: 1
1: 1
2: 3
3: 28
4: 312
Right 913532632 1:119743480-119743502 GGACCTGCCCCAGTCAGCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 252
913532620_913532630 27 Left 913532620 1:119743428-119743450 CCAGCCCAGCTGCAGCAAAACCT 0: 1
1: 1
2: 3
3: 28
4: 312
Right 913532630 1:119743478-119743500 TTGGACCTGCCCCAGTCAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 171
913532620_913532625 0 Left 913532620 1:119743428-119743450 CCAGCCCAGCTGCAGCAAAACCT 0: 1
1: 1
2: 3
3: 28
4: 312
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532620_913532627 8 Left 913532620 1:119743428-119743450 CCAGCCCAGCTGCAGCAAAACCT 0: 1
1: 1
2: 3
3: 28
4: 312
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532620_913532631 28 Left 913532620 1:119743428-119743450 CCAGCCCAGCTGCAGCAAAACCT 0: 1
1: 1
2: 3
3: 28
4: 312
Right 913532631 1:119743479-119743501 TGGACCTGCCCCAGTCAGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 192
913532620_913532623 -4 Left 913532620 1:119743428-119743450 CCAGCCCAGCTGCAGCAAAACCT 0: 1
1: 1
2: 3
3: 28
4: 312
Right 913532623 1:119743447-119743469 ACCTACAAAGCCTCCAGCCATGG 0: 1
1: 0
2: 1
3: 20
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913532620 Original CRISPR AGGTTTTGCTGCAGCTGGGC TGG (reversed) Intronic