ID: 913532621

View in Genome Browser
Species Human (GRCh38)
Location 1:119743432-119743454
Sequence TTGTAGGTTTTGCTGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913532621_913532625 -4 Left 913532621 1:119743432-119743454 CCCAGCTGCAGCAAAACCTACAA No data
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532621_913532632 25 Left 913532621 1:119743432-119743454 CCCAGCTGCAGCAAAACCTACAA No data
Right 913532632 1:119743480-119743502 GGACCTGCCCCAGTCAGCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 252
913532621_913532623 -8 Left 913532621 1:119743432-119743454 CCCAGCTGCAGCAAAACCTACAA No data
Right 913532623 1:119743447-119743469 ACCTACAAAGCCTCCAGCCATGG 0: 1
1: 0
2: 1
3: 20
4: 178
913532621_913532634 30 Left 913532621 1:119743432-119743454 CCCAGCTGCAGCAAAACCTACAA No data
Right 913532634 1:119743485-119743507 TGCCCCAGTCAGCTGGGGCTTGG 0: 1
1: 1
2: 2
3: 38
4: 322
913532621_913532627 4 Left 913532621 1:119743432-119743454 CCCAGCTGCAGCAAAACCTACAA No data
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532621_913532631 24 Left 913532621 1:119743432-119743454 CCCAGCTGCAGCAAAACCTACAA No data
Right 913532631 1:119743479-119743501 TGGACCTGCCCCAGTCAGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 192
913532621_913532630 23 Left 913532621 1:119743432-119743454 CCCAGCTGCAGCAAAACCTACAA No data
Right 913532630 1:119743478-119743500 TTGGACCTGCCCCAGTCAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913532621 Original CRISPR TTGTAGGTTTTGCTGCAGCT GGG (reversed) Intronic