ID: 913532622

View in Genome Browser
Species Human (GRCh38)
Location 1:119743433-119743455
Sequence TTTGTAGGTTTTGCTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913532622_913532632 24 Left 913532622 1:119743433-119743455 CCAGCTGCAGCAAAACCTACAAA No data
Right 913532632 1:119743480-119743502 GGACCTGCCCCAGTCAGCTGGGG 0: 1
1: 0
2: 4
3: 24
4: 252
913532622_913532635 30 Left 913532622 1:119743433-119743455 CCAGCTGCAGCAAAACCTACAAA No data
Right 913532635 1:119743486-119743508 GCCCCAGTCAGCTGGGGCTTGGG 0: 1
1: 0
2: 9
3: 17
4: 277
913532622_913532627 3 Left 913532622 1:119743433-119743455 CCAGCTGCAGCAAAACCTACAAA No data
Right 913532627 1:119743459-119743481 TCCAGCCATGGTAGGCGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 82
913532622_913532625 -5 Left 913532622 1:119743433-119743455 CCAGCTGCAGCAAAACCTACAAA No data
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532622_913532623 -9 Left 913532622 1:119743433-119743455 CCAGCTGCAGCAAAACCTACAAA No data
Right 913532623 1:119743447-119743469 ACCTACAAAGCCTCCAGCCATGG 0: 1
1: 0
2: 1
3: 20
4: 178
913532622_913532631 23 Left 913532622 1:119743433-119743455 CCAGCTGCAGCAAAACCTACAAA No data
Right 913532631 1:119743479-119743501 TGGACCTGCCCCAGTCAGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 192
913532622_913532634 29 Left 913532622 1:119743433-119743455 CCAGCTGCAGCAAAACCTACAAA No data
Right 913532634 1:119743485-119743507 TGCCCCAGTCAGCTGGGGCTTGG 0: 1
1: 1
2: 2
3: 38
4: 322
913532622_913532630 22 Left 913532622 1:119743433-119743455 CCAGCTGCAGCAAAACCTACAAA No data
Right 913532630 1:119743478-119743500 TTGGACCTGCCCCAGTCAGCTGG 0: 1
1: 0
2: 0
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913532622 Original CRISPR TTTGTAGGTTTTGCTGCAGC TGG (reversed) Intronic