ID: 913532625

View in Genome Browser
Species Human (GRCh38)
Location 1:119743451-119743473
Sequence ACAAAGCCTCCAGCCATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 175}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913532620_913532625 0 Left 913532620 1:119743428-119743450 CCAGCCCAGCTGCAGCAAAACCT 0: 1
1: 1
2: 3
3: 28
4: 312
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532619_913532625 8 Left 913532619 1:119743420-119743442 CCTGGTGGCCAGCCCAGCTGCAG 0: 1
1: 0
2: 4
3: 55
4: 420
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532618_913532625 9 Left 913532618 1:119743419-119743441 CCCTGGTGGCCAGCCCAGCTGCA 0: 1
1: 0
2: 1
3: 43
4: 418
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532617_913532625 20 Left 913532617 1:119743408-119743430 CCTGTGGCTGTCCCTGGTGGCCA 0: 1
1: 0
2: 3
3: 29
4: 280
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532621_913532625 -4 Left 913532621 1:119743432-119743454 CCCAGCTGCAGCAAAACCTACAA No data
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532613_913532625 29 Left 913532613 1:119743399-119743421 CCTGCTGGCCCTGTGGCTGTCCC 0: 1
1: 0
2: 6
3: 58
4: 421
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532616_913532625 21 Left 913532616 1:119743407-119743429 CCCTGTGGCTGTCCCTGGTGGCC No data
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175
913532622_913532625 -5 Left 913532622 1:119743433-119743455 CCAGCTGCAGCAAAACCTACAAA No data
Right 913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913532625 Original CRISPR ACAAAGCCTCCAGCCATGGT AGG Intronic
900647215 1:3714426-3714448 TCAAAGCCACCAGTCAGGGTGGG + Intronic
900754090 1:4421566-4421588 ACAAAGGCTTCAGCAACGGTTGG - Intergenic
901565713 1:10113137-10113159 AGAAAGCTTCCAGTCATGGCAGG + Intronic
904731045 1:32591507-32591529 ACAAAGACTCCAGCCCAGGGTGG - Intronic
904944365 1:34188586-34188608 CCAAAGCCTGCAGCCAGGCTTGG + Intronic
910290366 1:85594732-85594754 GCAAAGCATCCTGCCATAGTAGG - Intergenic
911676203 1:100661155-100661177 ACCATGCGTCCAGGCATGGTGGG - Intergenic
912670053 1:111617155-111617177 ACAAAGCCACGTGCCCTGGTGGG - Intronic
913532625 1:119743451-119743473 ACAAAGCCTCCAGCCATGGTAGG + Intronic
914853464 1:151332483-151332505 ACGAAGCCTCTAGCTTTGGTAGG + Intergenic
915449052 1:155992100-155992122 ACAAATTATCCAGGCATGGTGGG - Intronic
915999803 1:160604836-160604858 ACAAAGCCTCCAGCCAATTTGGG - Intergenic
916090868 1:161306746-161306768 AAAAACCCTCCAGACATAGTGGG - Exonic
916513283 1:165492553-165492575 TCAAAGCCTCCAGGGAGGGTTGG + Intergenic
917700383 1:177574542-177574564 ACAAAGGCTCCAGCAATGAAGGG + Intergenic
921334851 1:214075868-214075890 GCAAAACCTCCACCCAGGGTAGG - Intergenic
922715576 1:227869314-227869336 AGAAAGCTTCCACCCATGGAAGG - Intergenic
1063107118 10:3002146-3002168 ACCAACTCTACAGCCATGGTGGG - Intergenic
1063278966 10:4603368-4603390 GCACAGCCTCCAGCCAAGGCCGG - Intergenic
1063545444 10:6976523-6976545 AGGAAGCTTGCAGCCATGGTGGG - Intergenic
1070407394 10:76109260-76109282 ACAAGGCCTCCATCCTTGTTGGG + Intronic
1074452663 10:113571773-113571795 AGGAAGCCTCCAGCCAAGGTTGG - Intronic
1074866423 10:117546709-117546731 ACAAAGACTCCAGGCAGCGTGGG - Intronic
1076170890 10:128319042-128319064 CCAAAAGCACCAGCCATGGTAGG + Intergenic
1076465660 10:130679804-130679826 ACGAAGCTTCCAGTCATGGTGGG - Intergenic
1076611792 10:131730518-131730540 ACAAGGCCTTAAGCCACGGTTGG - Intergenic
1079273539 11:19012246-19012268 ACAAAGCCTCCAAGAATTGTGGG - Intergenic
1080738923 11:35045590-35045612 ACAAAGCTCCCAGCCTTGGTGGG - Intergenic
1084523906 11:69684230-69684252 ACAATGCCTCAGGCCATGGCAGG - Intergenic
1084965869 11:72744209-72744231 AGAAAGCACCCAGCCAGGGTTGG - Intronic
1085736238 11:79041686-79041708 TCAAATCCTCCAGTCTTGGTTGG + Intronic
1087821749 11:102720273-102720295 ACAAACCCTGCTGCAATGGTAGG + Intronic
1089399408 11:118155848-118155870 ACACAGTCCCCAGCCACGGTCGG + Intergenic
1093222787 12:16444226-16444248 CAGAAGCCTCCAGCCATGGAAGG - Intronic
1094111670 12:26869264-26869286 ACAAAGTTGCCAGCCATGATGGG - Intergenic
1095547208 12:43386655-43386677 ACAAAGCCTCCAAGAATTGTGGG - Intronic
1097238257 12:57554718-57554740 AGGAAGCTTCCAGTCATGGTGGG + Intronic
1099235959 12:80082937-80082959 ACAAAGCCTCCAACAAATGTGGG - Intergenic
1099973371 12:89523609-89523631 AACAGTCCTCCAGCCATGGTAGG + Exonic
1101782223 12:107846183-107846205 ACTCAGCCTCCAGCCAGGGCGGG - Intergenic
1102255274 12:111411401-111411423 AGAAAGCCTTTATCCATGGTAGG - Intronic
1107811812 13:44207695-44207717 AGAAAGCCTAAAGCCATTGTGGG + Intergenic
1111097958 13:83539080-83539102 CCAAAGCCACCAGCCAAGGTGGG + Intergenic
1111428716 13:88124428-88124450 ACAAATCCCCCAGCAATTGTAGG + Intergenic
1115273996 14:31586209-31586231 ACAAAGCCTCCAGCCTTGTGAGG + Intronic
1115835352 14:37396640-37396662 ACAAAGCCTCCAGGAAGGCTGGG - Intronic
1116049750 14:39788414-39788436 AGAAAGCCTCCAGCTTTGGAAGG - Intergenic
1118840494 14:69506376-69506398 ACAAACACTCAAGCCATGCTGGG + Intronic
1119434923 14:74592294-74592316 AGAAAACCTCCATCCATGGTGGG + Intronic
1119958264 14:78824231-78824253 ACTAAGTTTCCAGCCATGATGGG - Intronic
1121007656 14:90500615-90500637 GGAAAGACTCCAGACATGGTGGG + Intergenic
1121081230 14:91109869-91109891 TGAAAGCCTCCAGACATGGTCGG - Intronic
1122010841 14:98745548-98745570 ATAAAGCCTCCAGTTATGGCCGG - Intergenic
1122601998 14:102926069-102926091 GCAAAGCCTCCAGCCAAGGCAGG - Intronic
1123511332 15:21003007-21003029 ACAGAGCCTCCATCCATGAGTGG - Intergenic
1127779936 15:62303325-62303347 ACAAAGCCTCTAGCCCTGATAGG - Intergenic
1128065604 15:64762664-64762686 ACAAAGCCACCTGCTATGGCTGG - Intronic
1129753737 15:78083510-78083532 ACCAAGCCTACTGCCCTGGTGGG + Intronic
1131176645 15:90213458-90213480 ACAAGCCCTCCAGCCATGCTGGG - Intronic
1132629541 16:910531-910553 ACAGAGTCTCAGGCCATGGTGGG - Intronic
1133334716 16:4999625-4999647 ACAAAGAGGCCAGGCATGGTGGG + Intronic
1135307068 16:21376560-21376582 ACAAAGCCTCTAGGCAATGTTGG - Intergenic
1136349069 16:29695266-29695288 CCAGAGCCTCCAGCCATGACCGG + Intronic
1137083625 16:36096582-36096604 ACAAAGCCTCCAGGAATTATGGG - Intergenic
1138200925 16:55087780-55087802 TCAAAGCCTCCAGCGAGGCTGGG - Intergenic
1138647998 16:58439078-58439100 CCAACGCTCCCAGCCATGGTGGG + Intergenic
1138799004 16:60002863-60002885 ACAAAACTTACAGTCATGGTGGG - Intergenic
1140980012 16:80099083-80099105 AGAAAGCTTCCAATCATGGTGGG - Intergenic
1140987040 16:80167888-80167910 TCAAAGCCTCCACCCATGAAAGG - Intergenic
1141596302 16:85099122-85099144 ACAAAGCCTCCAGGCAGTCTGGG + Exonic
1142153132 16:88521442-88521464 AGAAAGCCTCAGGCCATCGTGGG + Intronic
1142266665 16:89067061-89067083 ACAAGCCATCCAGCCAGGGTCGG - Intergenic
1142755081 17:2011622-2011644 CCAAAGCCTCCAGGCAAGGGAGG - Intronic
1142876603 17:2854862-2854884 GCAGAGCCTCCAGCAATGGGGGG + Intronic
1144961229 17:19045240-19045262 ACAAAGCCTCCCTCCCTGATAGG - Intronic
1144973932 17:19129284-19129306 ACAAAGCCTCCCTCCCTGATAGG + Intronic
1146695267 17:34904036-34904058 ACCTAGCCAGCAGCCATGGTGGG + Intergenic
1147625382 17:41896684-41896706 CCAAAGCCTCCAGCCATCAGTGG - Intronic
1147674049 17:42192815-42192837 CCAAACCCTCCAGTCATGGTGGG - Intronic
1147948913 17:44096137-44096159 ACAAAGTCTCCAGCCAGGAAGGG + Intronic
1152283476 17:79398966-79398988 ACAAGGACACCAGTCATGGTGGG - Intronic
1152878651 17:82803178-82803200 ACAAAGCCTCGAGCCAAGGCTGG - Intronic
1203166883 17_GL000205v2_random:105599-105621 ACAAAGGCTCCTTCTATGGTTGG - Intergenic
1152972406 18:175358-175380 GAAAAGCCTCCAGTCATGGCTGG + Intronic
1156285389 18:35689177-35689199 AAAAGGCCTCCTGCCATGGTAGG - Exonic
1156466257 18:37349399-37349421 AGAAAGAATCCAGCCACGGTAGG - Intronic
1157757271 18:50230042-50230064 ACAAAGAGGCCAGGCATGGTGGG - Intronic
1159959916 18:74547385-74547407 ACAAAGCCTCAGGCCAAGGGTGG - Intronic
1161287525 19:3476723-3476745 ACAGAGCCCCCAGCCCTGGATGG + Intronic
1164042923 19:21509612-21509634 ATAAAGCCTCCTTCCATGGCTGG - Intronic
1164530404 19:29044023-29044045 AAAAAGTCACCTGCCATGGTTGG - Intergenic
1166174513 19:41057314-41057336 ACATATCCTCCAGCCATGAGGGG + Intergenic
1167674265 19:50874779-50874801 ACACAGCCACCTGCCAGGGTTGG - Exonic
1167991870 19:53367064-53367086 ACAAGGCCACCAGCTATGGAAGG - Intronic
1168463072 19:56577805-56577827 AGAAAGCCTTCAGCCATCGTGGG + Exonic
1202670462 1_KI270709v1_random:45257-45279 ACAAAGCCTCCAGGAATTATGGG + Intergenic
926260741 2:11258403-11258425 ACAAAGCCTCCTGCCTTGAAAGG - Intronic
928439384 2:31279231-31279253 ACAAAGCCTCCAGCCTTGCCCGG + Intergenic
929333527 2:40712702-40712724 ACAAAGCCTCCAGGAATTTTGGG - Intergenic
929995963 2:46826388-46826410 CCAAAGCCTCCTGCCACGGAAGG + Intronic
932500401 2:72178183-72178205 AACAAGCCACAAGCCATGGTTGG + Exonic
934250968 2:90355015-90355037 ACAAAGCCTCCAGGAATTATGGG - Intergenic
934258595 2:91448395-91448417 ACAAAGCCTCCAGGAATTATGGG + Intergenic
935637718 2:105262419-105262441 AGGAAGCTTCCAGCCATGGTGGG - Intergenic
939694277 2:145304843-145304865 ACAATGCCTCCAGCCACTGATGG + Intergenic
943736805 2:191365302-191365324 ATAAAGCCTCCATAAATGGTAGG + Intronic
943995439 2:194759280-194759302 AGAAAGCCTTCAGGCATGTTTGG - Intergenic
944264540 2:197709079-197709101 ACACTGTCTCCATCCATGGTAGG - Intronic
944933130 2:204540891-204540913 TCAAAGCCTTGAGCCATGGCTGG + Intergenic
945183155 2:207112344-207112366 AGAAGGCCTCCAGCCAGGCTAGG - Intronic
947527595 2:230888549-230888571 ACAAAGTCTACAGCAGTGGTCGG + Intergenic
947539574 2:230966573-230966595 ACAAAGTCTACAGCAGTGGTCGG - Intergenic
948083611 2:235227608-235227630 ACAAGTCCTTCAGCCATGGCTGG + Intergenic
948188438 2:236040211-236040233 ACAAAGCCACTCGCCAGGGTGGG - Intronic
1170755899 20:19206702-19206724 ACAGAGCTGCCAGCCATGGCAGG + Intergenic
1172885355 20:38227363-38227385 ACAAAGATTCCAGTCATGGAGGG - Intronic
1174086066 20:48008141-48008163 AGGAAGCTTCCAGTCATGGTGGG + Intergenic
1174268150 20:49346913-49346935 CCAAAGCCTCCAGGAGTGGTGGG - Intergenic
1174335744 20:49859186-49859208 ACAAACTCTCCAGCCACGGCTGG + Intronic
1175619162 20:60428822-60428844 CCCAAGCCTACAGCCATGGGAGG - Intergenic
1176075852 20:63247919-63247941 CCCAGGGCTCCAGCCATGGTGGG + Intronic
1176334676 21:5584958-5584980 ACAAAGGCTCCTTCCATGGTTGG + Intergenic
1176393081 21:6235990-6236012 ACAAAGGCTCCTTCCATGGTTGG - Intergenic
1176404872 21:6353498-6353520 ACAAAGGCTCCTTCTATGGTTGG + Intergenic
1176432285 21:6635606-6635628 ACAAAGGCTCCTTCTATGGTTGG - Intergenic
1176468338 21:7080184-7080206 ACAAAGGCTCCTTCCATGGTTGG + Intronic
1176491899 21:7461962-7461984 ACAAAGGCTCCTTCCATGGTTGG + Intergenic
1176508743 21:7676421-7676443 ACAAAGGCTCCTTCCATGGTTGG - Intergenic
1177822518 21:26046902-26046924 ACACAGACTCCAGCCATCGTGGG - Intronic
1178622679 21:34190247-34190269 ACAGAGCAGCCAGCCATGGAGGG + Intergenic
1179722789 21:43324948-43324970 GCAAGGCCTCAAGCCATGTTTGG + Intergenic
1180066530 21:45415303-45415325 ACAAAGCCTGCAGCCTGGGGTGG - Intronic
1180943928 22:19679429-19679451 ACAAAGCCACCACCCCTGGCTGG + Intergenic
1182132960 22:27871984-27872006 AGAAAGCTTACAGTCATGGTAGG - Intronic
1182455184 22:30445831-30445853 ACAAAGCATCCAGGCAGAGTGGG + Intergenic
1182522681 22:30893162-30893184 CCAGAGGCTCCAGCCATGCTTGG - Exonic
1184300596 22:43556478-43556500 TCAAAGCTCACAGCCATGGTGGG - Intronic
953183846 3:40620305-40620327 ACAATGCCTCCAGGCCAGGTAGG - Intergenic
955096346 3:55801860-55801882 ACAAACCCTCCAGGCAGGGCAGG - Intronic
956754256 3:72369665-72369687 ACTAAGTCTCCAGACATGGAGGG + Intergenic
958032326 3:88126966-88126988 ACAAAGCCTCCTGCCTTGAAAGG - Intronic
962317275 3:134366807-134366829 CGAAAGACTCCAGCCATGATGGG + Intronic
969686975 4:8681107-8681129 ACAGAGCCCCCAGCCTTGGTGGG + Intergenic
970949780 4:21741226-21741248 AGTAGGCCTCCAGCCATGGCAGG + Intronic
971128227 4:23777784-23777806 ACAAAGACTCTGGCCAAGGTTGG - Intronic
971256309 4:25016831-25016853 ACAAAGCCTCAAGTCATGTCAGG - Intronic
974263814 4:59559166-59559188 ACAAAGCCTCCAGGAAATGTGGG - Intergenic
976477325 4:85499573-85499595 ACCTAGCCTGCAGCCTTGGTGGG + Intronic
978627554 4:110704551-110704573 ACAAAGCCTTTTGCCATGTTAGG + Intergenic
982390386 4:154857345-154857367 ACAAAGGCTCCATCTCTGGTAGG + Intergenic
984486615 4:180378030-180378052 ACGAGGCTTCCAGCCATGATGGG - Intergenic
986352998 5:6897347-6897369 ATGATGCCTCCAGCCTTGGTTGG - Intergenic
994586625 5:101716796-101716818 ACAAAGTTCCCAGCCATGATAGG - Intergenic
995774662 5:115712178-115712200 CCTAAGCCTCCAGGCATGATGGG + Intergenic
997821399 5:137069373-137069395 ACAATGCCTGCTGCCATGCTGGG - Intronic
1002561743 5:180087203-180087225 AAAAAGCATCCAGGCATGGTGGG - Intergenic
1004371003 6:15051954-15051976 ACAGAGCTTGCAGCCCTGGTAGG - Intergenic
1007255798 6:40527518-40527540 TCAAAGTCTCCAGTCATGGAAGG + Intronic
1007338352 6:41171612-41171634 TAAAAGCTTCCAGCCATGGCAGG - Intergenic
1008164055 6:48113835-48113857 AAACAGCTCCCAGCCATGGTTGG - Intergenic
1009798631 6:68503913-68503935 ACAAAGCCTCCAGAAAGTGTGGG + Intergenic
1011099860 6:83708954-83708976 GCAAAGTCTCCAGCCCTGGCCGG + Intronic
1012083728 6:94794948-94794970 ACAAAACATCCACACATGGTAGG - Intergenic
1012901841 6:105015126-105015148 AAAAAGTCTCCAGCTATGCTTGG + Intronic
1016906834 6:149159198-149159220 ACAAAGCTTCCTGTCATGTTGGG + Intergenic
1017830451 6:158123342-158123364 ATAAGCCCTCCAGCCATGTTTGG - Intronic
1017986268 6:159445582-159445604 ACAAAGCCTGAGGCCATGGCTGG - Intergenic
1024194429 7:47045227-47045249 AGAAAGCCTGCAGCCAGGGCAGG + Intergenic
1025479287 7:60961935-60961957 ACAAAGCCTCCAGGAATTATGGG + Intergenic
1025552707 7:62270390-62270412 ACAAAGCCTCCAGGAATTATGGG - Intergenic
1028155796 7:87427906-87427928 ACAAAGTCTGCAGCCTAGGTTGG - Intronic
1032056937 7:128691213-128691235 ACAGAACTTCCAGCCATGGAAGG - Intergenic
1033821285 7:145137580-145137602 ACAAAGCTTCCAGTCACTGTTGG + Intergenic
1034350206 7:150410373-150410395 ACAAACTCTCCAGGCCTGGTGGG + Intronic
1034587731 7:152110532-152110554 AACAAACCTCCAGCCATTGTTGG - Exonic
1035064807 7:156096716-156096738 ACAAAGGTCCCAGCCCTGGTGGG + Intergenic
1035727961 8:1836275-1836297 ACAAAGCCTGCAGCCCAGGCAGG + Intronic
1036968896 8:13331976-13331998 ACAAAGACTCAAACCATGTTAGG + Intronic
1038226096 8:25659596-25659618 ACAAAGCCTCCAGGAATTATGGG - Intergenic
1038237215 8:25770510-25770532 ACAAAGCCTCCAGGAATTCTGGG + Intergenic
1038338370 8:26663348-26663370 ACAACTCCCCCAGCCATAGTAGG + Intergenic
1042757729 8:72235743-72235765 GCAAAACCACCAGCCATGATAGG - Intergenic
1047322343 8:123798997-123799019 ACACAACCTCCAGACATGGTAGG + Intronic
1055117544 9:72622194-72622216 CCATACCCTCCAGCAATGGTGGG + Intronic
1055156443 9:73068041-73068063 ACAAAGCCTCCAGGAATTTTGGG + Intronic
1056693001 9:88823891-88823913 ACAAAGACTCCAGTCTTTGTGGG + Intergenic
1059644224 9:116248538-116248560 AGAAAGCCTCCAGGCACAGTGGG + Intronic
1060386754 9:123237475-123237497 ACTAAGCCTTCAGCAATGGGAGG + Intronic
1060759955 9:126238660-126238682 ACACAGCCTTGAGCCATTGTAGG + Intergenic
1060891539 9:127192354-127192376 ACAGTGCCTCCAGCCAAGGCTGG + Intronic
1061333027 9:129909064-129909086 GCAAAGCCTGCAGCCATGGGGGG + Intronic
1062165421 9:135105117-135105139 AGGAAGCCTCCAGCCATGAGGGG + Intronic
1203426960 Un_GL000195v1:49962-49984 ACAAAGGCTCCTTCCATGATTGG - Intergenic
1203439253 Un_GL000195v1:173106-173128 ACAAAGGCTCCTTCTATGGTTGG + Intergenic
1191705258 X:64087088-64087110 ACAAAGCCTCCAAACAATGTGGG + Intergenic
1191768100 X:64723347-64723369 ACAAAGCCTCCAGGCTTGAAAGG - Intergenic
1193361563 X:80585541-80585563 ACAAAGCCTCCAGGCAATATGGG - Intergenic
1193937009 X:87635739-87635761 AGAAAGCCTGGAGCAATGGTTGG - Exonic
1195786153 X:108526181-108526203 ACAAAGGCTTCACCCAAGGTAGG - Intronic
1198396631 X:136225611-136225633 AGAAGGACTCCAGTCATGGTAGG - Intronic
1199281364 X:146003902-146003924 ACTAAGCGTGCAGCCATGGGAGG - Intergenic
1199676603 X:150194843-150194865 ATAAAGCCTCCAGTCCAGGTTGG - Intergenic
1199967659 X:152833357-152833379 TCTAAGGCTCCAGGCATGGTGGG - Intronic